Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

[RFC]: Broaden characters allowed in FASTA sequences #75

Closed
wants to merge 2 commits into from
Closed
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
2 changes: 1 addition & 1 deletion docs/src/manual/fasta.md
Original file line number Diff line number Diff line change
Expand Up @@ -113,7 +113,7 @@ To write a `BioSequence` to FASTA file, you first have to create a [`FASTA.Recor
using BioSequences
x = dna"aaaaatttttcccccggggg"
rec = FASTA.Record("MySeq", x)
open(FASTA.Writer, "my-out.fasta") do
open(FASTA.Writer, "my-out.fasta") do w
write(w, rec)
end
```
4 changes: 2 additions & 2 deletions src/fasta/readrecord.jl
Original file line number Diff line number Diff line change
Expand Up @@ -20,8 +20,8 @@ machine = (function ()
header.actions[:enter] = [:mark]
header.actions[:exit] = [:header]

# '*': terminal, `-': gap
letters = re"[A-Za-z*\-]+"
letters = re.rep1(re"[!-~]" \ re">")

letters.actions[:enter] = [:mark]
letters.actions[:exit] = [:letters]

Expand Down