UniquifyAllKmers does not find kmers at end of the sequence

[gcorsi]

The global_evaluation of the UniquifyAllKmers Specification does not find repeated kmers at the end of the sequence.

For instance, the following code results in a score of 0 (no kmers of size 10 repeated):

sequence = 'AGTTCCCGGTCACCTGAGCTCCGGGTGACGCGGCTGCGGTAGCATGGCGTCCCTCTTCAGTTCCCGGT'  
problem = DnaOptimizationProblem(sequence=sequence, constraints=[UniquifyAllKmers(k=10)])
for evaluation in problem.constraints_evaluations():
    print(evaluation.score)

However, the kmer AGTTCCCGGT is repeated, at the beginning and end of the sequence.

Suggested solution:

DnaChisel/dnachisel/builtin_specifications/UniquifyAllKmers.py

Line 230 in db5ddb0

for i in range(start, end - self.k):

change to: for i in range(start, end - self.k + 1):

DnaChisel/dnachisel/builtin_specifications/UniquifyAllKmers.py

Line 241 in db5ddb0

and (self.location.start <= start_ < end_ < self.location.end)

change to: and (self.location.start <= start_ < end_ <= self.location.end)

[veghp]

Many thanks for bringing attention to this and for the proposed solution. I managed to reproduce it and also implemented the change.