-
Notifications
You must be signed in to change notification settings - Fork 28
Home
Please note: the documentation is undergoing a rewrite! The following help pages are available:
- Installation instructions
- Information on built-in variant panels for
mykrobe predict
- How to run AMR prediction (the most common use of
mykrobe
)
Advanced topics:
- How to use custom variant panels.
- bioconda -
conda install -c bioconda mykrobe
- from source -
pip3 install . && mykrobe panels update_metadata && mykrobe panels update_species all
- or using singularity or docker (see wiki for details)
Run on Mtb, making a JSON file of results:
mykrobe predict my_sample_name tb \
--output out.json \
--format json \
--seq reads.fq.gz
You can test that mykrobe predict
runs as expected by downloading and running
on a small toy set of reads, as follows.
wget -O test_reads.fq.gz https://ndownloader.figshare.com/files/21059229
mykrobe predict SAMPLE tb --output out.json --format json --seq test_reads.fq.gz
The test reads are simulated, and perfectly match the reference, except for
the isoniazid resistant associated variant inhA I21T. You should see a section
like this in the output file out.json
:
"Isoniazid": {
"predict": "R",
"called_by": {
"inhA_I21T-ATC1674262ACT": {
... etc
The original README is below, but each section of it will gradually be replaced as the documentation is reorganised.
Table of Contents generated with DocToc
- Mykrobe
- Citation
- Tests
- Release
mykrobe --help
usage: mykrobe [-h] [--version]
{predict,panels,variants,vars,genotype} ...
optional arguments:
-h, --help show this help message and exit
--version mykrobe version
[sub-commands]:
{predict,panels,variants,vars,genotype}
predict predict the sample's drug susceptibility
panels A description of the AMR panels available within
Mykrobe predict
variants (vars) build variant probes
genotype genotype a sample using a probe set
Output is in CSV by default. For a more detailed output use the JSON format with --format json
.
{
"sample_id": {
"susceptibility": {
"Rifampicin": {
"predict": "S"
},
...
"Streptomycin": {
"predict": "S"
}
"phylogenetics": {
"lineage": {
"Unknown": {
"percent_coverage": -1,
"median_depth": -1
}
},
...
"species": {
"Mycobacterium_tuberculosis": {
"percent_coverage": 98.0,
"median_depth": 53
}
}
},
"typed_variants": {
"rpoB_N438S-AAC761118AGT": {
"info": {
"contamination_depths": [],
"coverage": {
"alternate": {
"percent_coverage": 47.62,
"median_depth": 0.0,
"min_depth": 0
},
"reference": {
"percent_coverage": 100.0,
"median_depth": 49.0,
"min_depth": 44.0
}
},
"expected_depths": [
56.0
]
},
"_cls": "Call.VariantCall",
"genotype": [
0,
0
],
"genotype_likelihoods": [
-4.25684443365591,
-99999999.0,
-99999999.0
]
}, ...
},
If you use one of the following panels please cite the relevant publications:
mykrobe predict tb_sample_id tb --panel walker-2015 -1 tb_sequence.bam
Walker, Timothy M., et al. "Whole-genome sequencing for prediction of Mycobacterium tuberculosis drug susceptibility and resistance: a retrospective cohort study." The Lancet Infectious Diseases 15.10 (2015): 1193-1202.
mykrobe predict tb_sample_id tb --panel bradley-2015 -1 tb_sequence.bam
Bradley, Phelim, et al. "Rapid antibiotic-resistance predictions from genome sequence data for Staphylococcus aureus and Mycobacterium tuberculosis." Nature communications 6 (2015).
mykrobe genotype --help
usage: mykrobe genotype [-h] [-k kmer] [--tmp TMP] [--keep_tmp]
[--skeleton_dir SKELETON_DIR] [-t THREADS] [-m MEMORY]
[--expected_depth EXPECTED_DEPTH] [-1 seq [seq ...]]
[-c ctx] [-f] [--ont] [--guess_sequence_method]
[--ignore_minor_calls]
[--ignore_filtered IGNORE_FILTERED] [--model model]
[--ploidy ploidy] [--filters FILTERS [FILTERS ...]]
[--report_all_calls]
[--expected_error_rate EXPECTED_ERROR_RATE]
[--min_variant_conf MIN_VARIANT_CONF]
[--min_gene_conf MIN_GENE_CONF]
[--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH]
[--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD]
[--output OUTPUT] [-q]
sample probe_set
positional arguments:
sample sample id
probe_set probe_set
optional arguments:
-h, --help show this help message and exit
-k kmer, --kmer kmer kmer length (default:21)
--tmp TMP tmp directory (default: tmp/)
--keep_tmp Dont remove tmp files
--skeleton_dir SKELETON_DIR
directory for skeleton binaries
-t THREADS, --threads THREADS
threads
-m MEMORY, --memory MEMORY
memory for graph constuction
--expected_depth EXPECTED_DEPTH
expected depth
-1 seq [seq ...], --seq seq [seq ...]
sequence files (fasta,fastq,bam)
-c ctx, --ctx ctx cortex graph binary
-f, --force force
--ont Set default for ONT data. Sets expected_error_rate to
0.15 and to haploid
--guess_sequence_method
Guess if ONT or Illumia based on error rate. If error
rate is > 10%, ploidy is set to haploid and a
confidence threshold is used
--ignore_minor_calls Ignore minor calls when running resistance prediction
--ignore_filtered IGNORE_FILTERED
don't include filtered genotypes
--model model Genotype model used, default kmer_count. Options
kmer_count, median_depth
--ploidy ploidy Use a diploid (includes 0/1 calls) or haploid
genotyping model
--filters FILTERS [FILTERS ...]
don't include filtered genotypes
--report_all_calls report all calls
--expected_error_rate EXPECTED_ERROR_RATE
Expected sequencing error rate. Set to 0.15 for ONT
genotyping.
--min_variant_conf MIN_VARIANT_CONF
minimum genotype confidence for variant genotyping
--min_gene_conf MIN_GENE_CONF
minimum genotype confidence for gene genotyping
--min_proportion_expected_depth MIN_PROPORTION_EXPECTED_DEPTH
minimum depth required on the sum of both alleles.
Default 0.3 (30%)
--min_gene_percent_covg_threshold MIN_GENE_PERCENT_COVG_THRESHOLD
all genes alleles found above this percent coverage
will be reported (default 100 (only best alleles
reported))
--output OUTPUT File path to save output json file as. Default is to
stdout.
-q, --quiet do not output warnings to stderr
mykrobe genotype sample_id example-data/staph-amr-bradley_2015.fasta -1 seq.fq
{
"sample_id": {
"files": [
"seq.fq "
],
"kmer": 21,
"sequence_calls": {
"mecA": {
"info": {
"copy_number": 0.0,
"contamination_depths": [],
"coverage": {
"percent_coverage": 0.0,
"median_depth": 0.0,
"min_non_zero_depth": 0.0
},
"expected_depths": [
1
]
},
"_cls": "Call.SequenceCall",
"genotype": [
0,
0
],
"genotype_likelihoods": [
-0.001,
-99999999.0,
-99999999.0
]
},
"fusA": {
"info": {
"copy_number": 1.0276923076923077,
"contamination_depths": [],
"version": "10",
"coverage": {
"percent_coverage": 100.0,
"median_depth": 167.0,
"min_non_zero_depth": 116.0
},
"expected_depths": [
162.5
]
},
"_cls": "Call.SequenceCall",
"genotype": [
1,
1
],
"genotype_likelihoods": [
-994.7978064088725,
-349.45246450237215,
-10.95808091830304
]
},
....
}
}
This is optional but will make any probe sets built more robust to variation in within k-1 bases of the key variants. This will require mongoDB > 3.0 running in the background.
usage: mykrobe variants add [-h] [--db_name db_name] [-f] [-q]
[-m METHOD]
vcf reference_set
positional arguments:
vcf a vcf file
reference_set reference set
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-f, --force force
-q, --quiet do not output warnings to stderr
-m METHOD, --method METHOD
variant caller method (e.g. CORTEX)
To add a VCF to the database db_name run
mykrobe variants add --db_name :db_name sample.vcf :reference
Use the --method
argument to specify the variant caller or pipeline used (if you'll have multiple Call Sets per sample)
mykrobe variants add --db_name :db_name --method CORTEX sample_cortex.vcf :reference
mykrobe variants make-probes --help
usage: mykrobe variants make-probes [-h] [--db_name db_name] [-q]
[-f VCF] [-v VARIANT] [-t TEXT_FILE]
[-g GENBANK] [-k KMER]
[--no-backgrounds]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
-f VCF, --vcf VCF Use variants defined in a VCF file
-v VARIANT, --variant VARIANT
Variant in DNA positions e.g. A1234T
-t TEXT_FILE, --text_file TEXT_FILE
Text file containing variants as rows A1234T
-g GENBANK, --genbank GENBANK
Genbank file containing genes as features
-k KMER, --kmer KMER kmer length
--no-backgrounds Build probe set against reference only ignoring nearby
variants
mykrobe variants make-probes -v A1234T example-data/NC_000962.3.fasta
To build a ProbeSet of all non-singleton variants in the database run:
`mykrobe variants dump-probes`
usage: mykrobe dump-probes [-h] [--db_name db_name] [-q] [--kmer kmer] [--force]
[-v]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
--kmer kmer kmer length
--force
-v, --verbose
mykrobe variants dump-probes reference_set.fasta > variant_probe_set.fasta
This will generate a probe set for each variant in the database. The resulting fasta file will look like the following:
>ref-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
TCGCCGCAGCGGTTGGCAACGATGTGGTGCGATCGCTAAAGATCACCGGGCCGGCGGCACCAT
...
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCATCAT
>alt-37d2eea6a23d526cbee4e00b901dc97885a88e7aa8721432b080dcc342b459ce
TCGCCGCAGCGGTTGGCAACGATGTGGTGCAATCGCTAAAGATCACCGGGCCGGCGGCACGAT
>ref-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347?num_alts=10&ref=56cf2e4ca9fefcd2b15de4d6
CTGTCGCTGGGAAGAGCGAATACGTCTGGACCAGGACGGGCTACCCGAACACGATATCTTTCG
>alt-2dab6387a677ac17f6bc181f47235a4196885723b34ceff3a05ffcbfd6834347
...
Where you have a series of variants represented as a set of alleles. The reference allele followed by multiple alternate alleles. You will end up with multiple alternate alleles if there are other variants that fall within k of the target variant.
Each variant is referenced by a var_hash
with is the hash of ":ref:pos:alt" which is indexed in the database and can be used to query for Variant object.
See mykrobe genotype
to use these probes to genotype a new sample.
mykrobe variants make-probes
allows you to build a probe set using Variants that are not already in the database but using the population variation to produce multiple alleles per variant.
usage: mykrobe variants make-probes [-h] [--db_name db_name] [-q] [-v VARIANT] [-f FILE]
[-g GENBANK] [-k KMER] [--no-backgrounds]
reference_filepath
positional arguments:
reference_filepath reference_filepath
optional arguments:
-h, --help show this help message and exit
--db_name db_name db_name
-q, --quiet do not output warnings to stderr
-v VARIANT, --variant VARIANT
Variant in DNA positions e.g. A1234T
-f FILE, --file FILE File containing variants as rows A1234T
-g GENBANK, --genbank GENBANK
Genbank file containing genes as features
-k KMER, --kmer KMER kmer length
--no-backgrounds Build probe set against reference only ignoring nearby
variants
First, define your variants for which you want to build probes. Columns are
ref/gene pos ref alt alphabet
ref 2522798 G T DNA
ref 3785555 A G DNA
ref 839793 C A DNA
ref 2734398 C G DNA
ref 3230861 T A DNA
ref 1018694 A T DNA
mykrobe variants make-probes --db_name :db_name -f variants.txt ref.fa > variant_probe_set.fa
You can also define your variants in terms of gene coordinates in amino acid or DNA space.
rpoB S431X PROT
rpoB F425X PROT
embB M306X PROT
rrs C513X DNA
gyrA D94X PROT
gid P75L PROT
gid V88A PROT
katG S315X PROT
To do this you must provide a genbank file defining the position of the variants in the reference (-g (GENBANK) )
mykrobe variants make-probes --db_name :db_name -f aa_variants.txt -g ref.gb ref.fa> gene_variant_probe_set.fa
Please cite us if you use Mykrobe predictor in a publication
To run tests:
Requires mongod
. Download.
mongod
and in another window.
pip install tox
tox
To run tests for a particular python version run, e.g. python 3.6:
tox -e py36
See dist/README.md