diff --git a/src/Album-Examples/AlbEditorShortcutExamples.class.st b/src/Album-Examples/AlbEditorShortcutExamples.class.st
index 8c133b6..970569f 100644
--- a/src/Album-Examples/AlbEditorShortcutExamples.class.st
+++ b/src/Album-Examples/AlbEditorShortcutExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbEditorShortcutExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Shortcuts',
-	#package : 'Album-Examples',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorShortcutExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShortcutExamples >> deleteOneLetterAfterCursorWithSelection [
 	<gtExample>
 	| anEditorElement anEditor |
@@ -34,7 +32,7 @@ AlbEditorShortcutExamples >> deleteOneLetterAfterCursorWithSelection [
 	^ anEditorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShortcutExamples >> deleteOneLetterAfterCursorWithSelectionBeforeCursor [
 	<gtExample>
 	| anEditorElement anEditor |
@@ -59,7 +57,7 @@ AlbEditorShortcutExamples >> deleteOneLetterAfterCursorWithSelectionBeforeCursor
 	^ anEditorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShortcutExamples >> deleteOneLetterBeforeCursorWithSelection [
 	<gtExample>
 	| anEditorElement anEditor |
@@ -84,7 +82,7 @@ AlbEditorShortcutExamples >> deleteOneLetterBeforeCursorWithSelection [
 	^ anEditorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShortcutExamples >> deleteOneLetterBeforeCursorWithSelectionAfterCursor [
 	<gtExample>
 	| anEditorElement anEditor |
diff --git a/src/Album-Examples/AlbEditorTextFlowLayoutExamples.class.st b/src/Album-Examples/AlbEditorTextFlowLayoutExamples.class.st
index bf655f2..b2a0ce9 100644
--- a/src/Album-Examples/AlbEditorTextFlowLayoutExamples.class.st
+++ b/src/Album-Examples/AlbEditorTextFlowLayoutExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbEditorTextFlowLayoutExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Layout',
-	#package : 'Album-Examples',
-	#tag : 'Layout'
+	#name : #AlbEditorTextFlowLayoutExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Layout'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbEditorTextFlowLayoutExamples >> container [
 	<gtExample>
 	| anElement |
@@ -25,7 +23,7 @@ AlbEditorTextFlowLayoutExamples >> container [
 	^ anElement
 ]
 
-{ #category : 'examples - layout' }
+{ #category : #'examples - layout' }
 AlbEditorTextFlowLayoutExamples >> container_extent [
 	<gtExample>
 	| aContainer |
@@ -38,7 +36,7 @@ AlbEditorTextFlowLayoutExamples >> container_extent [
 	^ aContainer
 ]
 
-{ #category : 'examples - layout' }
+{ #category : #'examples - layout' }
 AlbEditorTextFlowLayoutExamples >> layout_no_memory_leak [
 	<gtExample>
 	| aContainer |
diff --git a/src/Album-Examples/AlbEmbeddedEditorExamples.class.st b/src/Album-Examples/AlbEmbeddedEditorExamples.class.st
index 76d6330..65ec36e 100644
--- a/src/Album-Examples/AlbEmbeddedEditorExamples.class.st
+++ b/src/Album-Examples/AlbEmbeddedEditorExamples.class.st
@@ -1,14 +1,12 @@
 Class {
-	#name : 'AlbEmbeddedEditorExamples',
-	#superclass : 'AlbTextEditorExamples',
+	#name : #AlbEmbeddedEditorExamples,
+	#superclass : #AlbTextEditorExamples,
 	#traits : 'TAlbTextEditorFixedMeasurerExamples',
 	#classTraits : 'TAlbTextEditorFixedMeasurerExamples classTrait',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbEmbeddedEditorExamples >> editorFor: aText [
 	<return: #AlbEditorElement>
 	| anEditor aRopedText |
@@ -37,7 +35,7 @@ AlbEmbeddedEditorExamples >> editorFor: aText [
 	^ anEditor
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbEmbeddedEditorExamples >> editorWithEmbeddedEditor [
 
 	<gtExample>
@@ -47,19 +45,19 @@ AlbEmbeddedEditorExamples >> editorWithEmbeddedEditor [
 	^ ed
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbEmbeddedEditorExamples >> elementWithEmbeddedEditor [
 	<gtExample>
 	
 	^ self newElement editor: self editorWithEmbeddedEditor
 ]
 
-{ #category : 'private - instance creation' }
+{ #category : #'private - instance creation' }
 AlbEmbeddedEditorExamples >> embeddedEditorText [
 	^ 'Hello world' asRopedText
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbEmbeddedEditorExamples >> embeddedTextEditorElement [
 	"<gtExample>"
 	| anEditorElement |
@@ -83,12 +81,12 @@ AlbEmbeddedEditorExamples >> embeddedTextEditorElement [
 	^ anEditorElement
 ]
 
-{ #category : 'private - instance creation' }
+{ #category : #'private - instance creation' }
 AlbEmbeddedEditorExamples >> mainEditorText [
 	^ self newThreeLineText fontSize: 20
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbEmbeddedEditorExamples >> makeFixedMeasurement: aTextEditor [
 
 	aTextEditor
@@ -101,14 +99,14 @@ AlbEmbeddedEditorExamples >> makeFixedMeasurement: aTextEditor [
 			aTextElement ]
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbEmbeddedEditorExamples >> newThreeLineText [
 	<gtExample>
 	
 	^ ('first' , String cr , 'second' , String cr , 'third') asRopedText
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbEmbeddedEditorExamples >> textWithEmbeddedEditor [
 	<script: 'self new textWithEmbeddedEditor'>
 	| aText |
diff --git a/src/Album-Examples/AlbExamplesSeeClassSide.class.st b/src/Album-Examples/AlbExamplesSeeClassSide.class.st
index 590c92e..2c0fefb 100644
--- a/src/Album-Examples/AlbExamplesSeeClassSide.class.st
+++ b/src/Album-Examples/AlbExamplesSeeClassSide.class.st
@@ -1,26 +1,24 @@
 Class {
-	#name : 'AlbExamplesSeeClassSide',
-	#superclass : 'Object',
+	#name : #AlbExamplesSeeClassSide,
+	#superclass : #Object,
 	#classVars : [
 		'BigString'
 	],
-	#category : 'Album-Examples-TRY-HERE',
-	#package : 'Album-Examples',
-	#tag : 'TRY-HERE'
+	#category : #'Album-Examples-TRY-HERE'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExamplesSeeClassSide class >> ascent [
 	^ -20
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> bigString [
 	"1000000000 is 1Go, ~200 000 pages in LibreOffice - 3 600 000 lines on TextMaker "
 	^ BigString ifNil: [ BigString := String loremIpsum: 1000000000 ]
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> bigStringFromFile [
 	" self bigStringFromFile "
 
@@ -32,7 +30,7 @@ AlbExamplesSeeClassSide class >> bigStringFromFile [
 	stream close
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> bigStringToFile [
 	" self bigStringToFile "
 
@@ -44,18 +42,18 @@ AlbExamplesSeeClassSide class >> bigStringToFile [
 	stream close
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> cleanUp [ 
 	super cleanUp.
 	BigString := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExamplesSeeClassSide class >> descent [
 	^ 20
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> embeddedFontsText [
 
 	"
@@ -121,7 +119,7 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 	^ text
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithHighlight [
 
 	| ed space text |
@@ -145,7 +143,7 @@ AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithHighlight [
 	^ ed
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithSubtextElement [
 
 	| ed space text size start |
@@ -155,26 +153,37 @@ AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithSubtextElement [
 	ed text: text.
 	size := 10.
 	start := 1.
-	1 to: 25 do: [ :pos | | deco  |
-		deco := (AlbSubtextElement editorElement: ed) interval: (start to: start + size); yourself.
+	1 to: 25 do: [ :pos |
+		| deco |
+		deco := (AlbSubtextElement editorElement: ed)
+			        interval: (start to: start + size);
+			        yourself.
 		deco withExtentChangeAdaption.
 		deco background: (Color random alpha: 0.4).
-		deco border: (BlBorder empty).
-		deco when: BlClickEvent do: [ :event | event currentTarget removeFromParent ].
-		deco when: BlMouseEnterEvent do: [ :event | event currentTarget border: (BlBorder paint: Color black width: 1) ].
-		deco when: BlMouseLeaveEvent do: [ :event | event currentTarget border: (BlBorder empty) ].
+		deco border: BlBorder empty.
+		deco addEventHandler: (BlEventHandler
+				 on: BlClickEvent
+				 do: [ :event | event currentTarget removeFromParent ]).
+		deco addEventHandler: (BlEventHandler
+				 on: BlMouseEnterEvent
+				 do: [ :event |
+					 event currentTarget border:
+						 (BlBorder paint: Color black width: 1) ]).
+		deco addEventHandler: (BlEventHandler
+				 on: BlMouseLeaveEvent
+				 do: [ :event | event currentTarget border: BlBorder empty ]).
 		ed frontLayer addChild: deco.
 		start := start + size + 5 ].
 
 	space := BlSpace new.
 	space root addChild: ed.
 	space title: 'editor'.
-	space extent: 400@200.
+	space extent: 400 @ 200.
 	space show.
 	^ ed
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithoutAnyDresser [
 
 	| ed space |
@@ -190,7 +199,7 @@ AlbExamplesSeeClassSide class >> example_EditorAsTextAreaWithoutAnyDresser [
 	^ ed
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorPharoChangesText [
 
 	| ed vscrollBar space text |
@@ -213,9 +222,8 @@ AlbExamplesSeeClassSide class >> example_EditorPharoChangesText [
 
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithAllFonts [
-
 	"
 AeFontSlant: normal italic oblique.
 AeFontWeight: black bold extraBlack extraBold extraLight light medium normal semiBold semiLight thin
@@ -223,17 +231,19 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 "
 
 	| aManager allSlants allWeights allStreches root text child allChars vscrollBar |
-	allChars := 'azertyuiopqsdfghjklmwxcvbn' , String cr , 'AZERTYUIOPQSDFGHJKLMWXCVBN' , String cr , '1234567890'
-	            , String cr , '@&é"''(§è!çà)-#°_¨*%£+/.?' , String cr , '€^$`ù=:;,~|'.
+	allChars := 'azertyuiopqsdfghjklmwxcvbn' , String cr
+	            , 'AZERTYUIOPQSDFGHJKLMWXCVBN' , String cr , '1234567890'
+	            , String cr , '@&é"''(§è!çà)-#°_¨*%£+/.?' , String cr
+	            , '€^$`ù=:;,~|'.
 	AeFontManager resetGlobalInstance.
-	aManager := AeFontManager globalInstance .
+	aManager := AeFontManager globalInstance.
 	aManager scanEmbeddedFonts.
 	aManager scanDefaultDirectories.
-	allSlants := { 
+	allSlants := {
 		             BlFontSlant normal.
 		             BlFontSlant italic.
 		             BlFontSlant oblique }.
-	allWeights := { 
+	allWeights := {
 		              BlFontWeight normal.
 		              BlFontWeight light.
 		              BlFontWeight extraLight.
@@ -244,7 +254,7 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 		              BlFontWeight black.
 		              BlFontWeight extraBlack.
 		              BlFontWeight thin }.
-	allStreches := { 
+	allStreches := {
 		               BlFontStretch normal.
 		               BlFontStretch condensed.
 		               BlFontStretch semiCondensed.
@@ -255,21 +265,21 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 		               BlFontStretch extraExpanded.
 		               BlFontStretch ultraExpanded }.
 
-	root := BlElement new constraintsDo: [ :c | 
+	root := BlElement new constraintsDo: [ :c |
 		        c vertical matchParent.
 		        c horizontal matchParent ].
 	text := '' asRopedText.
-	aManager familyNames do: [ :fname | 
-		allSlants do: [ :slant | 
-			allWeights do: [ :weight | 
-				allStreches do: [ :strech | 
+	aManager familyNames do: [ :fname |
+		allSlants do: [ :slant |
+			allWeights do: [ :weight |
+				allStreches do: [ :strech |
 					(aManager
 						 detectFamilyName: fname
 						 slant: (AeFontSlant perform: slant name asSymbol)
 						 weight: (AeFontWeight perform: weight name asSymbol)
 						 stretch: (AeFontStretch perform: strech name asSymbol)
-						 ifNone: [  ]) in: [ :face | 
-						face ifNotNil: [ 
+						 ifNone: [  ]) in: [ :face |
+						face ifNotNil: [
 							| fontBuilder t |
 							fontBuilder := BlTextFontAndStyleBuilder new.
 							fontBuilder familyName: fname.
@@ -280,23 +290,24 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 							t := allChars copy asRopedText.
 							fontBuilder font applyOnText: t.
 							text append:
-								(String cr , String cr , String cr , fname , ' slant: ' , slant name , ' weight: ' , weight name , ' strech: '
+								(String cr , String cr , String cr , fname , ' slant: '
+								 , slant name , ' weight: ' , weight name , ' strech: '
 								 , strech name , ' ' , String cr , String cr) asRopedText.
 							text append: t ] ] ] ] ] ].
 	child := text onAlbum.
 	vscrollBar := BlVerticalScrollbarElement new.
 	vscrollBar constraintsDo: [ :c |
-			c ignoreByLayout.
-			c margin: (BlInsets right: 2).
-			c ignored horizontal alignRight.
-			c ignored vertical alignBottom]. 
+		c ignoreByLayout.
+		c margin: (BlInsets right: 2).
+		c ignored horizontal alignRight.
+		c ignored vertical alignBottom ].
 	vscrollBar attachTo: child infinite.
 	root addChild: child.
 	root addChild: vscrollBar.
-	root openInOBlSpace
+	root openInSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithBigText [
 
 	| ed |
@@ -310,7 +321,7 @@ AlbExamplesSeeClassSide class >> example_EditorWithBigText [
 	ed openInSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithDynamicAttribute [
 "
 broken in GlamorousToolKit but what to do with that ?
@@ -374,7 +385,7 @@ broken in GlamorousToolKit but what to do with that ?
 	^ text
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithEmbeddedFonts [
 
 	"
@@ -393,7 +404,7 @@ AeFontStretch: condensed expanded extraCondensed extraExpanded normal semiConden
 	root openInOBlSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithLorem [
 
 	| ed space hscrollBar |
@@ -418,7 +429,7 @@ AlbExamplesSeeClassSide class >> example_EditorWithLorem [
 	^ed
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithReplacingAdornment [
 
 	| aText ed |
@@ -432,7 +443,7 @@ AlbExamplesSeeClassSide class >> example_EditorWithReplacingAdornment [
 	ed openInSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithSegNumbers [
 
 	| ed t |
@@ -447,7 +458,7 @@ AlbExamplesSeeClassSide class >> example_EditorWithSegNumbers [
 	ed openInOBlSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_EditorWithTGCA [
 
 	| ed tgca tgcaText colorIndex vscrollBar space |
@@ -487,7 +498,7 @@ AlbExamplesSeeClassSide class >> example_EditorWithTGCA [
 	
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_RopedTextWithDifferentFontSize [
 
 	(' Default font and size' asRopedText
@@ -499,7 +510,7 @@ AlbExamplesSeeClassSide class >> example_RopedTextWithDifferentFontSize [
 		openInSpace
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithClickAndHoverAttributes [
 
 	| text styler editorElement space clickText hoverText |
@@ -530,7 +541,7 @@ AlbExamplesSeeClassSide class >> example_WithClickAndHoverAttributes [
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithCrLfOnly [
 
 	| ed space |
@@ -542,7 +553,7 @@ AlbExamplesSeeClassSide class >> example_WithCrLfOnly [
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithCrOnly [
 
 	| ed space |
@@ -554,7 +565,7 @@ AlbExamplesSeeClassSide class >> example_WithCrOnly [
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithCrWithCrLf [
 
 	| ed space |
@@ -565,7 +576,7 @@ AlbExamplesSeeClassSide class >> example_WithCrWithCrLf [
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithEmptyText [
 
 	| ed space |
@@ -575,7 +586,7 @@ AlbExamplesSeeClassSide class >> example_WithEmptyText [
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithEmptyTextFitContents [
 
 	| ed space |
@@ -591,7 +602,7 @@ self flag: 'does not work'.
 	space show
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> example_WithHelloWorld [
 
 	| ed space text editor |
@@ -605,27 +616,27 @@ AlbExamplesSeeClassSide class >> example_WithHelloWorld [
 	space show
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbExamplesSeeClassSide class >> glyphHeight [
 	^ self ascent abs + self descent
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbExamplesSeeClassSide class >> glyphWidth [
 	^ 30
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbExamplesSeeClassSide class >> lineSpacing [
 	^ 5
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbExamplesSeeClassSide class >> paragraphMargin [
 	^ BlInsets all: 15
 ]
 
-{ #category : 'editor examples' }
+{ #category : #'editor examples' }
 AlbExamplesSeeClassSide class >> tgcaString [
 	^ 'ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTT
 AACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAAC
@@ -699,11 +710,11 @@ GAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGT
 GGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTT'
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbExamplesSeeClassSide class >> wordPadding [
 	^ BlInsets top: 3 bottom: 3
 ]
 
-{ #category : 'see class side' }
+{ #category : #'see class side' }
 AlbExamplesSeeClassSide >> seeClassSide [
 ]
diff --git a/src/Album-Examples/AlbTextAttributesHowToGuide.class.st b/src/Album-Examples/AlbTextAttributesHowToGuide.class.st
index c87d3ba..7aa7f18 100644
--- a/src/Album-Examples/AlbTextAttributesHowToGuide.class.st
+++ b/src/Album-Examples/AlbTextAttributesHowToGuide.class.st
@@ -9,14 +9,12 @@ Class: AlbTextAttributesHowToGuide
 `AlbTextAttributesHowToGuide class>>#hideMarkupInText`
 "
 Class {
-	#name : 'AlbTextAttributesHowToGuide',
-	#superclass : 'Object',
-	#category : 'Album-Examples-! Documentation',
-	#package : 'Album-Examples',
-	#tag : '! Documentation'
+	#name : #AlbTextAttributesHowToGuide,
+	#superclass : #Object,
+	#category : 'Album-Examples-! Documentation'
 }
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextAttributesHowToGuide class >> hideMarkupInText [
 
 	<script>
@@ -57,7 +55,7 @@ AlbTextAttributesHowToGuide class >> hideMarkupInText [
 	^ (AlbEditorElement new text: text) openInOBlSpace
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextAttributesHowToGuide class >> linkInText [
 	<script>
 	| text |
diff --git a/src/Album-Examples/AlbTextCursorAttributeExamples.class.st b/src/Album-Examples/AlbTextCursorAttributeExamples.class.st
index b834f1b..965f479 100644
--- a/src/Album-Examples/AlbTextCursorAttributeExamples.class.st
+++ b/src/Album-Examples/AlbTextCursorAttributeExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextCursorAttributeExamples',
-	#superclass : 'AlbTextEditorAdornmentsExamples',
-	#category : 'Album-Examples-! Documentation',
-	#package : 'Album-Examples',
-	#tag : '! Documentation'
+	#name : #AlbTextCursorAttributeExamples,
+	#superclass : #AlbTextEditorAdornmentsExamples,
+	#category : 'Album-Examples-! Documentation'
 }
 
-{ #category : 'public' }
+{ #category : #public }
 AlbTextCursorAttributeExamples class >> changingForeground [
 	<script>
 	| text |
diff --git a/src/Album-Examples/AlbTextEditorAdornmentsExamples.class.st b/src/Album-Examples/AlbTextEditorAdornmentsExamples.class.st
index 08091ab..8567acb 100644
--- a/src/Album-Examples/AlbTextEditorAdornmentsExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorAdornmentsExamples.class.st
@@ -9,9 +9,7 @@ Adornment attribute can replace a piece of text with arbitrary visual elements o
 # appending ${class:AlbTextEditorAppendingAdornmentsExamples}$
 "
 Class {
-	#name : 'AlbTextEditorAdornmentsExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-! Documentation',
-	#package : 'Album-Examples',
-	#tag : '! Documentation'
+	#name : #AlbTextEditorAdornmentsExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-! Documentation'
 }
diff --git a/src/Album-Examples/AlbTextEditorByScripterExamples.class.st b/src/Album-Examples/AlbTextEditorByScripterExamples.class.st
index 9870938..b306761 100644
--- a/src/Album-Examples/AlbTextEditorByScripterExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorByScripterExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorByScripterExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-By scripter',
-	#package : 'Album-Examples',
-	#tag : 'By scripter'
+	#name : #AlbTextEditorByScripterExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-By scripter'
 }
 
-{ #category : 'click - adornment element' }
+{ #category : #'click - adornment element' }
 AlbTextEditorByScripterExamples class >> click_adornment_element [
 	<script>
 	| aScripter |
@@ -34,7 +32,7 @@ AlbTextEditorByScripterExamples class >> click_adornment_element [
 	^ aScripter
 ]
 
-{ #category : 'click - empty' }
+{ #category : #'click - empty' }
 AlbTextEditorByScripterExamples class >> click_empty [
 	<script>
 	| aScripter |
@@ -56,20 +54,20 @@ AlbTextEditorByScripterExamples class >> click_empty [
 	^ aScripter
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorByScripterExamples class >> scripter [
 	
 	^ BlDevScripter new
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorByScripterExamples class >> scripterElement [
 
 	^ AlbEditorElement new
 		text: '' asRopedText
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorByScripterExamples class >> scripterWithElement [
 	| aScripter |
 
@@ -89,7 +87,7 @@ AlbTextEditorByScripterExamples class >> scripterWithElement [
 	^ aScripter
 ]
 
-{ #category : 'click - adornment element' }
+{ #category : #'click - adornment element' }
 AlbTextEditorByScripterExamples class >> textWithAdornment [
 
 	^ 'Hello world
diff --git a/src/Album-Examples/AlbTextEditorExamples.class.st b/src/Album-Examples/AlbTextEditorExamples.class.st
index 44cd407..e0d17bb 100644
--- a/src/Album-Examples/AlbTextEditorExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorExamples.class.st
@@ -31,31 +31,29 @@
 
 "
 Class {
-	#name : 'AlbTextEditorExamples',
-	#superclass : 'Object',
+	#name : #AlbTextEditorExamples,
+	#superclass : #Object,
 	#classInstVars : [
 		'loremIpsum'
 	],
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> adormentDynamicAttribute [
 	<script>
 	
 	^ self newElement editor: self editorWithAdormentDynamicAttribute
 ]
 
-{ #category : 'cleanup' }
+{ #category : #cleanup }
 AlbTextEditorExamples class >> cleanUp [
 	super cleanUp.
 	
 	loremIpsum := nil 
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> editorWithAdormentDynamicAttribute [
 	<gtExample>
 	| editor text |
@@ -74,7 +72,7 @@ AlbTextEditorExamples class >> editorWithAdormentDynamicAttribute [
 	^ editor
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> editorWithAdormentDynamicAttributeReturningEmptyCollection [
 	<gtExample>
 	| editor text |
@@ -89,7 +87,7 @@ AlbTextEditorExamples class >> editorWithAdormentDynamicAttributeReturningEmptyC
 	^ editor
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> editorWithAdormentDynamicAttributeReturningTwoElements [
 	<script>
 	| editor text |
@@ -112,7 +110,7 @@ AlbTextEditorExamples class >> editorWithAdormentDynamicAttributeReturningTwoEle
 	^ editor inspect
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> editorWithAlbumText [
 	<gtExample>
 	| anEditor aText |
@@ -123,7 +121,7 @@ AlbTextEditorExamples class >> editorWithAlbumText [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> editorWithLastHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -134,13 +132,13 @@ AlbTextEditorExamples class >> editorWithLastHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - editor' }
+{ #category : #'examples - editor' }
 AlbTextEditorExamples class >> editorWithMethod [
 	<gtExample>
 	^ self newEditor text: self newMethodText
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> editorWithSecondHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -151,14 +149,14 @@ AlbTextEditorExamples class >> editorWithSecondHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> editorWithText [
 
 	<gtExample>
 	^ self newEditor privateText: self newText
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> elementOnMethodWithSyntaxHighlighting [
 	<gtExample>
 	| element styler text editor |
@@ -173,28 +171,28 @@ AlbTextEditorExamples class >> elementOnMethodWithSyntaxHighlighting [
 	^ element
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> elementWithEditor [
 	<gtExample>
 	
 	^ self newElement editor: self editorWithText
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> elementWithEmptyEditor [
 	<gtExample>
 	
 	^ self newElement editor: (self newEditor text: (' ' asRopedText fontSize: 16; monospace))
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> elementWithMethod [
 	<gtExample>
 	
 	^ self newElement editor: self editorWithMethod
 ]
 
-{ #category : 'examples - comparison' }
+{ #category : #'examples - comparison' }
 AlbTextEditorExamples class >> exampleEditor [
 	| space editorElement editor text |
 	editorElement := AlbEditorElement new.
@@ -213,7 +211,7 @@ AlbTextEditorExamples class >> exampleEditor [
 	space show
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> exampleMethodTextOpen [
 	| space editorElement |
 
@@ -235,7 +233,7 @@ AlbTextEditorExamples class >> exampleMethodTextOpen [
 	space show.
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> exampleMethodTextOpenEmbedElement [
 	<script>
 	| space editorElement |
@@ -257,7 +255,7 @@ AlbTextEditorExamples class >> exampleMethodTextOpenEmbedElement [
 	space show.
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorExamples class >> exampleTextOpen [
 
 	<script>
@@ -278,12 +276,12 @@ AlbTextEditorExamples class >> exampleTextOpen [
 	space show
 ]
 
-{ #category : 'examples - comparison' }
+{ #category : #'examples - comparison' }
 AlbTextEditorExamples class >> extent [
 	^ 600@400
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertAStringAfterLastHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -293,7 +291,7 @@ AlbTextEditorExamples class >> insertAStringAfterLastHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertAStringAfterSecondHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -303,7 +301,7 @@ AlbTextEditorExamples class >> insertAStringAfterSecondHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertLineFeedString [
 	<gtExample>
 	| anEditor |
@@ -313,7 +311,7 @@ AlbTextEditorExamples class >> insertLineFeedString [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertLineFeedStringAfterLastHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -323,7 +321,7 @@ AlbTextEditorExamples class >> insertLineFeedStringAfterLastHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertLineFeedStringAfterSecondHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -333,7 +331,7 @@ AlbTextEditorExamples class >> insertLineFeedStringAfterSecondHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> insertLineFeedStringBeforeSecondHiddenCharacter [
 	<gtExample>
 	| anEditor |
@@ -343,12 +341,12 @@ AlbTextEditorExamples class >> insertLineFeedStringBeforeSecondHiddenCharacter [
 	^ anEditor
 ]
 
-{ #category : 'examples - comparison' }
+{ #category : #'examples - comparison' }
 AlbTextEditorExamples class >> loremIpsum [
 	^ self loremIpsum: 1000000
 ]
 
-{ #category : 'examples - comparison' }
+{ #category : #'examples - comparison' }
 AlbTextEditorExamples class >> loremIpsum: aLength [
 	loremIpsum ifNil: [ loremIpsum := Dictionary new ].
 	^ loremIpsum
@@ -356,7 +354,7 @@ AlbTextEditorExamples class >> loremIpsum: aLength [
 			ifAbsentPut: [ String loremIpsum: aLength ]
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> newBeReplaceTextAttribute [
 	<gtExample>
 	^ AlbTextAdornmentDynamicAttribute new
@@ -366,14 +364,14 @@ AlbTextEditorExamples class >> newBeReplaceTextAttribute [
 			background: Color lightGray ]
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorExamples class >> newEditor [
 	<gtExample>
 
 	^ AlbTextEditor new 
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorExamples class >> newElement [
 	<gtExample>
 	
@@ -384,41 +382,41 @@ AlbTextEditorExamples class >> newElement [
 		yourself
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorExamples class >> newMethodText [
 	<gtExample>
 	
 	^ (AlbTextEditorExamples class >> #fullDrawOn:) sourceCode asRopedText
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorExamples class >> newText [
 	<gtExample>
 	
 	^ (String loremIpsum: 2000000) asRopedText
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorExamples class >> newThreeLineText [
 	<gtExample>
 	
 	^ ('first' , String cr , 'second' , String cr , 'third') asRopedText
 ]
 
-{ #category : 'examples - editing' }
+{ #category : #'examples - editing' }
 AlbTextEditorExamples class >> simpleString [
 	<gtExample>
 	^ 'Album'
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbTextEditorExamples >> newEditor [
 	<gtExample>
 
 	^ AlbTextEditor new "beLineBased"
 ]
 
-{ #category : 'examples - embedded' }
+{ #category : #'examples - embedded' }
 AlbTextEditorExamples >> newElement [
 	<gtExample>
 	
diff --git a/src/Album-Examples/AlbTextEditorLayoutMeasurementExamples.class.st b/src/Album-Examples/AlbTextEditorLayoutMeasurementExamples.class.st
index eb110f3..4797bcc 100644
--- a/src/Album-Examples/AlbTextEditorLayoutMeasurementExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorLayoutMeasurementExamples.class.st
@@ -1,14 +1,12 @@
 Class {
-	#name : 'AlbTextEditorLayoutMeasurementExamples',
-	#superclass : 'Object',
+	#name : #AlbTextEditorLayoutMeasurementExamples,
+	#superclass : #Object,
 	#traits : 'TAlbTextEditorFixedMeasurerExamples',
 	#classTraits : 'TAlbTextEditorFixedMeasurerExamples classTrait',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorLayoutMeasurementExamples >> editorFor: aText [
 	<return: #AlbEditorElement>
 	| anEditor aRopedText |
@@ -38,7 +36,7 @@ AlbTextEditorLayoutMeasurementExamples >> editorFor: aText [
 	^ anEditor
 ]
 
-{ #category : 'examples - measurement' }
+{ #category : #'examples - measurement' }
 AlbTextEditorLayoutMeasurementExamples >> fit_content_Hello [
 	<gtExample>
 	<noTest>
@@ -52,7 +50,7 @@ AlbTextEditorLayoutMeasurementExamples >> fit_content_Hello [
 	^ anEditorElement
 ]
 
-{ #category : 'examples - measurement' }
+{ #category : #'examples - measurement' }
 AlbTextEditorLayoutMeasurementExamples >> fit_content_Hello_World [
 	<gtExample>
 	<noTest>
diff --git a/src/Album-Examples/AlbTextEditorMementoExamples.class.st b/src/Album-Examples/AlbTextEditorMementoExamples.class.st
index 77b7fd7..6b0a1eb 100644
--- a/src/Album-Examples/AlbTextEditorMementoExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorMementoExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorMementoExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Model',
-	#package : 'Album-Examples',
-	#tag : 'Model'
+	#name : #AlbTextEditorMementoExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Model'
 }
 
-{ #category : 'examples - memento' }
+{ #category : #'examples - memento' }
 AlbTextEditorMementoExamples >> editorRestoreState [
 	<gtExample>
 	| aMemento aTextEditor |
@@ -19,7 +17,7 @@ AlbTextEditorMementoExamples >> editorRestoreState [
 	^ aTextEditor
 ]
 
-{ #category : 'examples - memento' }
+{ #category : #'examples - memento' }
 AlbTextEditorMementoExamples >> editorSaveState [
 	<gtExample>
 	| aTextEditor aMemento |
@@ -30,7 +28,7 @@ AlbTextEditorMementoExamples >> editorSaveState [
 	^ aMemento
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorMementoExamples >> newTextEditor [
 	<gtExample>
 	| aTextEditor |
@@ -39,7 +37,7 @@ AlbTextEditorMementoExamples >> newTextEditor [
 	^ aTextEditor
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorMementoExamples >> textEditorWithState [
 	<gtExample>
 	| aTextEditor |
diff --git a/src/Album-Examples/AlbTextEditorOnObjectPrintStringExamples.class.st b/src/Album-Examples/AlbTextEditorOnObjectPrintStringExamples.class.st
index 09aa55d..703b295 100644
--- a/src/Album-Examples/AlbTextEditorOnObjectPrintStringExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorOnObjectPrintStringExamples.class.st
@@ -1,26 +1,24 @@
 Class {
-	#name : 'AlbTextEditorOnObjectPrintStringExamples',
-	#superclass : 'AlbTextEditorExamples',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #AlbTextEditorOnObjectPrintStringExamples,
+	#superclass : #AlbTextEditorExamples,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'example - Object>>#printString' }
+{ #category : #'example - Object>>#printString' }
 AlbTextEditorOnObjectPrintStringExamples >> editorOnObjectPrintString [
 	<gtExample>
 
 	^ self newEditor text: self textObjectPrintString
 ]
 
-{ #category : 'example - Object>>#printString' }
+{ #category : #'example - Object>>#printString' }
 AlbTextEditorOnObjectPrintStringExamples >> elementOnObjectPrintString [
 	<gtExample>
 	
 	^ self newElement editor: self editorOnObjectPrintString
 ]
 
-{ #category : 'example - Object>>#printString' }
+{ #category : #'example - Object>>#printString' }
 AlbTextEditorOnObjectPrintStringExamples >> textObjectPrintString [
 	<gtExample>
 	
diff --git a/src/Album-Examples/AlbTextEditorParagraphAttributesExamples.class.st b/src/Album-Examples/AlbTextEditorParagraphAttributesExamples.class.st
index 513352d..6a51d00 100644
--- a/src/Album-Examples/AlbTextEditorParagraphAttributesExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorParagraphAttributesExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorParagraphAttributesExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #AlbTextEditorParagraphAttributesExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorParagraphAttributesExamples >> editorElement [
 	<gtExample>
 	| textEditor editorElement |
@@ -21,7 +19,7 @@ AlbTextEditorParagraphAttributesExamples >> editorElement [
 	^ editorElement
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorParagraphAttributesExamples >> helloEditor [
 	<gtExample>
 	| anEditorElement |
@@ -45,7 +43,7 @@ AlbTextEditorParagraphAttributesExamples >> helloEditor [
 	^ anEditorElement
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorParagraphAttributesExamples >> helloText [
 	<gtExample>
 	| aText |
diff --git a/src/Album-Examples/AlbTextEditorReplacingAdornmentsExamples.class.st b/src/Album-Examples/AlbTextEditorReplacingAdornmentsExamples.class.st
index b2d633a..d931825 100644
--- a/src/Album-Examples/AlbTextEditorReplacingAdornmentsExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorReplacingAdornmentsExamples.class.st
@@ -18,14 +18,12 @@ They can also overlapp. In this case attributes that end first take precedence o
 
 "
 Class {
-	#name : 'AlbTextEditorReplacingAdornmentsExamples',
-	#superclass : 'AlbTextEditorAdornmentsExamples',
-	#category : 'Album-Examples-! Documentation',
-	#package : 'Album-Examples',
-	#tag : '! Documentation'
+	#name : #AlbTextEditorReplacingAdornmentsExamples,
+	#superclass : #AlbTextEditorAdornmentsExamples,
+	#category : 'Album-Examples-! Documentation'
 }
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithMultipleOverlappingReplacements [
 	<script>
 	<description: 'Multiple replacements can overlapp. In this case the order of the added elements is defined by the end index of the intervals of the attributes'>
@@ -48,7 +46,7 @@ AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithMultipleOver
 	^ (AlbEditorElement new text: aText) openInOBlSpace 
 ]
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithMultipleReplacementsOnTopEachOther [
 	<script>
 	<description: 'Multiple replacements can stack up. The order of added elements is defined by the order in which the attributes are added'>
@@ -70,7 +68,7 @@ AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithMultipleRepl
 	^ aText onAlbum openInOBlSpace 
 ]
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementAll [
 	<script>
 	<description: 'Even the whole line of text can be replaced'>
@@ -86,7 +84,7 @@ AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementA
 	^ aText onAlbum openInOBlSpace 
 ]
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementFirst [
 	<script>
 	<description: 'We can replace the first word in a sentence'>
@@ -103,7 +101,7 @@ AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementF
 	^ aText onAlbum openInOBlSpace 
 ]
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementLast [
 	<script>
 	<description: 'We can replace the last word in a sentence'>
@@ -120,7 +118,7 @@ AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementL
 	^ aText onAlbum openInOBlSpace 
 ]
 
-{ #category : 'examples - replacements' }
+{ #category : #'examples - replacements' }
 AlbTextEditorReplacingAdornmentsExamples class >> singleLineTextWithReplacementMiddle [
 	<script>
 	<description: 'We can replace a word in the middle of a sentence'>
diff --git a/src/Album-Examples/AlbTextEditorSegmentCollectorExamples.class.st b/src/Album-Examples/AlbTextEditorSegmentCollectorExamples.class.st
index 1b1cf6a..661d999 100644
--- a/src/Album-Examples/AlbTextEditorSegmentCollectorExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorSegmentCollectorExamples.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorSegmentCollectorExamples',
-	#superclass : 'Object',
+	#name : #AlbTextEditorSegmentCollectorExamples,
+	#superclass : #Object,
 	#instVars : [
 		'largeFile'
 	],
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollectorExamples >> deleteLargeFile [
 
 	largeFile ifNotNil: 
@@ -17,7 +15,7 @@ AlbTextEditorSegmentCollectorExamples >> deleteLargeFile [
 		largeFile := nil ].
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollectorExamples >> largeFile [
 	<gtExample>
 
@@ -31,14 +29,14 @@ AlbTextEditorSegmentCollectorExamples >> largeFile [
 		largeFile ].
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollectorExamples >> largeFileRope [
 
 	^ BlRopedText file: self largeFile
 		"self largeFile contents asRopedText"
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples >> segmentAt142 [
 	"Retrieve the segment at 1.42 times the cache limit.
 	This tests accessing the cache outside its initial contents.
@@ -55,7 +53,7 @@ AlbTextEditorSegmentCollectorExamples >> segmentAt142 [
 	self assert: actual equals: expected.
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples >> segmentAt200and262 [
 	"Retrieve the segment at line 200, followed by the segment at line 262.
 	This tests re-using part of the previously cached items where the index of the segments collection is not the same as the line number"
@@ -77,7 +75,7 @@ AlbTextEditorSegmentCollectorExamples >> segmentAt200and262 [
 
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples >> segmentAt242and42 [
 	"Retrieve the segment at line 2.42 times the cache limit, followed by the segment at line 42.
 	This tests #computeBackwardAt:."
@@ -109,7 +107,7 @@ AlbTextEditorSegmentCollectorExamples >> segmentAt242and42 [
 
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples >> segmentAt42 [
 	"Retrieve the segment at line 42.
 	Assumes the cache limit is always greater than 42."
@@ -122,7 +120,7 @@ AlbTextEditorSegmentCollectorExamples >> segmentAt42 [
 	self assert: actual equals: expected.
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples >> segmentAt80and120 [
 	"Retrieve the segment at 0.8 times the cache limit, followed by the segment at 1.2 times the cache limit.
 	This tests re-using part of the previously cached items"
@@ -144,13 +142,13 @@ AlbTextEditorSegmentCollectorExamples >> segmentAt80and120 [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollectorExamples >> segmentCollector [
 
 	^ self textEditor segmentCollector
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollectorExamples >> textEditor [ 
 	| aTextEditor |
 
diff --git a/src/Album-Examples/AlbTextEditorSegmentCollectorExamples2.class.st b/src/Album-Examples/AlbTextEditorSegmentCollectorExamples2.class.st
index 828480e..509dd60 100644
--- a/src/Album-Examples/AlbTextEditorSegmentCollectorExamples2.class.st
+++ b/src/Album-Examples/AlbTextEditorSegmentCollectorExamples2.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorSegmentCollectorExamples2',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #AlbTextEditorSegmentCollectorExamples2,
+	#superclass : #Object,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples2 >> retrieveLimitPlusOne [
 	<gtExample>
 	| string limit editor collector |
@@ -34,7 +32,7 @@ AlbTextEditorSegmentCollectorExamples2 >> retrieveLimitPlusOne [
 
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSegmentCollectorExamples2 >> retrieveWithinLimit [
 	<gtExample>
 	| string cacheLimit limit editor collector |
diff --git a/src/Album-Examples/AlbTextEditorSurroundMapExamples.class.st b/src/Album-Examples/AlbTextEditorSurroundMapExamples.class.st
index 92014ad..6272e66 100644
--- a/src/Album-Examples/AlbTextEditorSurroundMapExamples.class.st
+++ b/src/Album-Examples/AlbTextEditorSurroundMapExamples.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorSurroundMapExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #AlbTextEditorSurroundMapExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSet [
 	<gtExample>
 
@@ -26,7 +24,7 @@ AlbTextEditorSurroundMapExamples >> surroundSet [
 
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSetClosing [
 	<gtExample>
 
@@ -40,7 +38,7 @@ AlbTextEditorSurroundMapExamples >> surroundSetClosing [
 	^opening
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSetClosingAbsent [
 	<gtExample>
 
@@ -54,7 +52,7 @@ AlbTextEditorSurroundMapExamples >> surroundSetClosingAbsent [
 	^definition
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSetOpeningAbsent [
 	<gtExample>
 
@@ -69,7 +67,7 @@ AlbTextEditorSurroundMapExamples >> surroundSetOpeningAbsent [
 	^definition
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSetOpeningConditionRejects [
 	<gtExample>
 
@@ -84,7 +82,7 @@ AlbTextEditorSurroundMapExamples >> surroundSetOpeningConditionRejects [
 	^definition
 ]
 
-{ #category : 'examples' }
+{ #category : #examples }
 AlbTextEditorSurroundMapExamples >> surroundSetOpeningPresent [
 	<gtExample>
 
diff --git a/src/Album-Examples/AlbTextStylerExamples.class.st b/src/Album-Examples/AlbTextStylerExamples.class.st
index 9ec5427..66aded3 100644
--- a/src/Album-Examples/AlbTextStylerExamples.class.st
+++ b/src/Album-Examples/AlbTextStylerExamples.class.st
@@ -2,28 +2,26 @@
 Hello World *https://gtoolkit.com*
 "
 Class {
-	#name : 'AlbTextStylerExamples',
-	#superclass : 'Object',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #AlbTextStylerExamples,
+	#superclass : #Object,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'examples - editor' }
+{ #category : #'examples - editor' }
 AlbTextStylerExamples >> codeSnippetStyler [
 	<gtExample>
 
 	^ BlRBTextStyler new classOrMetaClass: BlElement
 ]
 
-{ #category : 'examples - editor' }
+{ #category : #'examples - editor' }
 AlbTextStylerExamples >> editorWithMethod [
 	<gtExample>
 
 	^ self newEditor text: self newMethodText
 ]
 
-{ #category : 'examples - styler strategy' }
+{ #category : #'examples - styler strategy' }
 AlbTextStylerExamples >> editorWithSyncStylerStrategy [
 	<gtExample>
 	| anEditor anEditorElement aStyler theTextAttributes |
@@ -42,21 +40,21 @@ AlbTextStylerExamples >> editorWithSyncStylerStrategy [
 	
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextStylerExamples >> newEditor [
 	<gtExample>
 
 	^ AlbTextEditor new
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextStylerExamples >> newMethodText [
 	<gtExample>
 	
 	^ (BlElement >> #applyLayoutSafelyIn:context:) sourceCode asRopedText
 ]
 
-{ #category : 'defaults' }
+{ #category : #defaults }
 AlbTextStylerExamples >> timeoutMilliseconds [
 	^ 500
 ]
diff --git a/src/Album-Examples/TAlbTextEditorFixedMeasurerExamples.trait.st b/src/Album-Examples/TAlbTextEditorFixedMeasurerExamples.trait.st
index 5f088d9..3450dca 100644
--- a/src/Album-Examples/TAlbTextEditorFixedMeasurerExamples.trait.st
+++ b/src/Album-Examples/TAlbTextEditorFixedMeasurerExamples.trait.st
@@ -2,23 +2,21 @@
 I add utility methods related to fixed text measurer
 "
 Trait {
-	#name : 'TAlbTextEditorFixedMeasurerExamples',
-	#category : 'Album-Examples-Editor',
-	#package : 'Album-Examples',
-	#tag : 'Editor'
+	#name : #TAlbTextEditorFixedMeasurerExamples,
+	#category : 'Album-Examples-Editor'
 }
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> ascent [
 	^ -20
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> descent [
 	^ 20
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 TAlbTextEditorFixedMeasurerExamples >> editorFor: aText [
 	<return: #AlbEditorElement>
 	| anEditor aRopedText |
@@ -48,7 +46,7 @@ TAlbTextEditorFixedMeasurerExamples >> editorFor: aText [
 	^ anEditor
 ]
 
-{ #category : 'private - instance creation' }
+{ #category : #'private - instance creation' }
 TAlbTextEditorFixedMeasurerExamples >> fixedMeasurer [
 	^ BlSpartaTextElementMockedMeasurer new
 		ascent: self ascent;
@@ -57,27 +55,27 @@ TAlbTextEditorFixedMeasurerExamples >> fixedMeasurer [
 		glyphHeight: self glyphHeight
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> glyphHeight [
 	^ self ascent abs + self descent
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> glyphWidth [
 	^ 30
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> lineSpacing [
 	^ 5
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> paragraphMargin [
 	^ BlInsets all: 15
 ]
 
-{ #category : 'private - font metrics' }
+{ #category : #'private - font metrics' }
 TAlbTextEditorFixedMeasurerExamples >> wordPadding [
 	^ BlInsets top: 3 bottom: 3
 ]
diff --git a/src/Album-Examples/package.st b/src/Album-Examples/package.st
index f355edc..f355c89 100644
--- a/src/Album-Examples/package.st
+++ b/src/Album-Examples/package.st
@@ -1 +1 @@
-Package { #name : 'Album-Examples' }
+Package { #name : #'Album-Examples' }
diff --git a/src/Album/AlbAbstractSubtextElement.class.st b/src/Album/AlbAbstractSubtextElement.class.st
index ca267dd..68426ea 100644
--- a/src/Album/AlbAbstractSubtextElement.class.st
+++ b/src/Album/AlbAbstractSubtextElement.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbAbstractSubtextElement',
-	#superclass : 'AlbTextPortionElement',
+	#name : #AlbAbstractSubtextElement,
+	#superclass : #AlbTextPortionElement,
 	#instVars : [
 		'editorElement',
 		'updateStrategy'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbAbstractSubtextElement class >> editorElement: anEditorElement [
 
 	^ (self basicNew editorElement: anEditorElement)
@@ -18,13 +16,13 @@ AlbAbstractSubtextElement class >> editorElement: anEditorElement [
 		  yourself
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> defaultGeometry [
 
 	^ BlPolygonGeometry new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> defaultUpdateStrategy [
 
 	^ AlbSubtextElementNoUpdateStrategy new.
@@ -32,19 +30,19 @@ AlbAbstractSubtextElement >> defaultUpdateStrategy [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbAbstractSubtextElement >> editorElement [
 
 	^ editorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbAbstractSubtextElement >> editorElement: anEditorElement [
 
 	editorElement := anEditorElement
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> initialize [ 
 
 	super initialize.
@@ -53,7 +51,7 @@ AlbAbstractSubtextElement >> initialize [
 	self initializeUpdateStrategy
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> initializeUpdateStrategy [
 
 	self updateStrategy: self defaultUpdateStrategy
@@ -61,7 +59,7 @@ AlbAbstractSubtextElement >> initializeUpdateStrategy [
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> updateStrategy: aSubTextUpdateStrategy [
 
 	updateStrategy ifNotNil: [ updateStrategy onUninstalledIn: self ].
@@ -72,31 +70,31 @@ AlbAbstractSubtextElement >> updateStrategy: aSubTextUpdateStrategy [
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbAbstractSubtextElement >> updateVertices [
 
 	self subclassResponsibility 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbAbstractSubtextElement >> vertices [
 
 	^ self geometry vertices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbAbstractSubtextElement >> vertices: aCollectionOfPoints [
 
 	self geometry: (BlPolygonGeometry new vertices: aCollectionOfPoints).
 ]
 
-{ #category : 'configuration' }
+{ #category : #configuration }
 AlbAbstractSubtextElement >> withExtentChangeAdaption [
 
 	self updateStrategy: AlbSubtextElementUpdateOnExtentChangeStrategy new
 ]
 
-{ #category : 'configuration' }
+{ #category : #configuration }
 AlbAbstractSubtextElement >> withoutAdaption [
 
 	self updateStrategy: AlbSubtextElementNoUpdateStrategy new
diff --git a/src/Album/AlbCursorBlinkingTask.class.st b/src/Album/AlbCursorBlinkingTask.class.st
index 45091dd..26dedd4 100644
--- a/src/Album/AlbCursorBlinkingTask.class.st
+++ b/src/Album/AlbCursorBlinkingTask.class.st
@@ -3,34 +3,32 @@ I'm a simple task that manage cursor blinking.
 
 "
 Class {
-	#name : 'AlbCursorBlinkingTask',
-	#superclass : 'BlRepeatedTask',
+	#name : #AlbCursorBlinkingTask,
+	#superclass : #BlRepeatedTask,
 	#instVars : [
 		'cursor'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorBlinkingTask >> cursor: aCursorElement [
 	cursor := aCursorElement
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorBlinkingTask >> defaultBlinkingDelay [ 
 
 	^ 600 milliSeconds 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorBlinkingTask >> initialize [
 	super initialize.
 	self delay: self defaultBlinkingDelay 
 ]
 
-{ #category : 'api - running' }
+{ #category : #'api - running' }
 AlbCursorBlinkingTask >> onRun [
 
 	cursor visibility: (cursor visibility isHidden
@@ -38,7 +36,7 @@ AlbCursorBlinkingTask >> onRun [
 			 ifFalse: [ BlVisibility hidden ])
 ]
 
-{ #category : 'api - running' }
+{ #category : #'api - running' }
 AlbCursorBlinkingTask >> stop [
 	super stop.
 	cursor visibility: BlVisibility visible 
diff --git a/src/Album/AlbCursorElement.class.st b/src/Album/AlbCursorElement.class.st
index 2a67a83..86e1c6c 100644
--- a/src/Album/AlbCursorElement.class.st
+++ b/src/Album/AlbCursorElement.class.st
@@ -1,41 +1,39 @@
 Class {
-	#name : 'AlbCursorElement',
-	#superclass : 'BlElement',
+	#name : #AlbCursorElement,
+	#superclass : #BlElement,
 	#instVars : [
 		'textPosition',
 		'blinking',
 		'blinkTask'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorElement >> beBlinking: aBoolean [
 
 	blinking := aBoolean
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> defaultBackground [
 
 	^ Color red 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> defaultBlinking [
 
 	^ true
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> defaultBlurredBackground [
 
 	^ Color brown 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> initialize [
 
 	super initialize.
@@ -51,13 +49,13 @@ AlbCursorElement >> initialize [
 		c vertical matchParent ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> newBlinkingTask [
 
 	^ AlbCursorBlinkingTask new cursor: self
 ]
 
-{ #category : 'private - focus' }
+{ #category : #'private - focus' }
 AlbCursorElement >> onGotFocus [
 
 	self background: self defaultBackground.
@@ -65,14 +63,14 @@ AlbCursorElement >> onGotFocus [
 	 
 ]
 
-{ #category : 'private - focus' }
+{ #category : #'private - focus' }
 AlbCursorElement >> onLostFocus [
 
 	self background: self defaultBlurredBackground.
 	self stopBlinkingTask 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> startBlinkingTask [
 
 	self stopBlinkingTask.
@@ -82,7 +80,7 @@ AlbCursorElement >> startBlinkingTask [
 	self enqueueTask: (blinkTask := self newBlinkingTask)
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorElement >> stopBlinkingTask [
 
 	blinkTask ifNotNil: [ 
@@ -92,12 +90,12 @@ AlbCursorElement >> stopBlinkingTask [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorElement >> textPosition [
 	^ textPosition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorElement >> textPosition: anInteger [
 
 	textPosition := anInteger
diff --git a/src/Album/AlbCursorMovedEvent.class.st b/src/Album/AlbCursorMovedEvent.class.st
index 58b2ecd..a15c3cd 100644
--- a/src/Album/AlbCursorMovedEvent.class.st
+++ b/src/Album/AlbCursorMovedEvent.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbCursorMovedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbCursorMovedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'cursor',
 		'oldIndex',
 		'newIndex',
 		'dueTo'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbCursorMovedEvent class >> cursor: aCursor from: anOldIndex to: aNewIndex [
 	<return: #AlbCursorMovedEvent>
 
@@ -22,7 +20,7 @@ AlbCursorMovedEvent class >> cursor: aCursor from: anOldIndex to: aNewIndex [
 		newIndex: aNewIndex
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbCursorMovedEvent class >> cursor: aCursor from: anOldIndex to: aNewIndex dueTo: aTextEditorOperator [
 	<return: #AlbCursorMovedEvent>
 	
@@ -33,48 +31,48 @@ AlbCursorMovedEvent class >> cursor: aCursor from: anOldIndex to: aNewIndex dueT
 		dueTo: aTextEditorOperator
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> cursor [
 	<return: #AlbTextEditorSingleCursor>
 
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> cursor: aTextEditorSingleCursor [
 	cursor := aTextEditorSingleCursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> dueTo [
 	^ dueTo
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> dueTo: aTextEditorOperator [
 	dueTo := aTextEditorOperator
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> newIndex [
 	<return: #Number>
 
 	^ newIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> newIndex: aNumber [
 	newIndex := aNumber
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> oldIndex [
 	<return: #Number>
 
 	^ oldIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorMovedEvent >> oldIndex: aNumber [
 	oldIndex := aNumber
 ]
diff --git a/src/Album/AlbCursorReachedBoundaryEvent.class.st b/src/Album/AlbCursorReachedBoundaryEvent.class.st
index 30ecd11..29c9764 100644
--- a/src/Album/AlbCursorReachedBoundaryEvent.class.st
+++ b/src/Album/AlbCursorReachedBoundaryEvent.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbCursorReachedBoundaryEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbCursorReachedBoundaryEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'cursor',
 		'boundary'
@@ -9,43 +9,41 @@ Class {
 		'Bottom',
 		'Top'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'class initialization' }
+{ #category : #'class initialization' }
 AlbCursorReachedBoundaryEvent class >> initialize [
 	Top := #top.
 	Bottom := #bottom
 ]
 
-{ #category : 'location' }
+{ #category : #location }
 AlbCursorReachedBoundaryEvent >> beBottom [
 	boundary := Bottom
 ]
 
-{ #category : 'location' }
+{ #category : #location }
 AlbCursorReachedBoundaryEvent >> beTop [
 	boundary := Top
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorReachedBoundaryEvent >> cursor [
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorReachedBoundaryEvent >> cursor: anObject [
 	cursor := anObject
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbCursorReachedBoundaryEvent >> isBottom [
 	^ boundary = Bottom
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbCursorReachedBoundaryEvent >> isTop [
 	^ boundary = Top
 ]
diff --git a/src/Album/AlbCursorStencil.class.st b/src/Album/AlbCursorStencil.class.st
index ce24159..63ef512 100644
--- a/src/Album/AlbCursorStencil.class.st
+++ b/src/Album/AlbCursorStencil.class.st
@@ -17,18 +17,16 @@ See the #create comment about the current instance variable
 
 "
 Class {
-	#name : 'AlbCursorStencil',
-	#superclass : 'BlStencil',
+	#name : #AlbCursorStencil,
+	#superclass : #BlStencil,
 	#instVars : [
 		'currentCursorElement',
 		'cursorColor'
 	],
-	#category : 'Album-UI-Stencils',
-	#package : 'Album',
-	#tag : 'UI-Stencils'
+	#category : 'Album-UI-Stencils'
 }
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbCursorStencil >> create [
 	"Pay attention: a CursorElement ** must be a singleton **. 
 	If not, dbl clicking will not work because the target of the first click may 
@@ -42,26 +40,26 @@ AlbCursorStencil >> create [
 		                          yourself
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorStencil >> currentCursorElement [
 
 	^ currentCursorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorStencil >> cursorColor [
 
 	^ cursorColor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbCursorStencil >> cursorColor: aColor [
 
 	cursorColor := aColor.
 	currentCursorElement := nil
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbCursorStencil >> initialize [ 
 
 	super initialize.
diff --git a/src/Album/AlbEditabilityMode.class.st b/src/Album/AlbEditabilityMode.class.st
index 776b110..765113c 100644
--- a/src/Album/AlbEditabilityMode.class.st
+++ b/src/Album/AlbEditabilityMode.class.st
@@ -1,42 +1,40 @@
 Class {
-	#name : 'AlbEditabilityMode',
-	#superclass : 'Object',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbEditabilityMode,
+	#superclass : #Object,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditabilityMode >> defaultEditorElementEventHandlers [
 
 	^ self subclassResponsibility 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditabilityMode >> defaultFrontLayerEventHandlers [
 
 	^ self subclassResponsibility 
 ]
 
-{ #category : 'shortcut management' }
+{ #category : #'shortcut management' }
 AlbEditabilityMode >> defaultShortcuts [
 
 	^ self subclassResponsibility 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditabilityMode >> defaultWordStencil [ 
 
 	^ AlbTextWordPieceStencil readOnly
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbEditabilityMode >> isEditable [
 
 	^ false
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditabilityMode >> primarySelectionElementIn: anEditorElement [
 
 	^ AlbPrimarySelectionElement editorElement: anEditorElement
diff --git a/src/Album/AlbEditableMode.class.st b/src/Album/AlbEditableMode.class.st
index 3f335f5..dd19a5d 100644
--- a/src/Album/AlbEditableMode.class.st
+++ b/src/Album/AlbEditableMode.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbEditableMode',
-	#superclass : 'AlbEditabilityMode',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbEditableMode,
+	#superclass : #AlbEditabilityMode,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditableMode >> defaultEditorElementEventHandlers [
 
 	^ { 
@@ -16,14 +14,14 @@ AlbEditableMode >> defaultEditorElementEventHandlers [
 		  AlbTextEditorFocusHandler new }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditableMode >> defaultFrontLayerEventHandlers [
 
 	^ {  AlbTextEditorCursorIconHandler new.
 		  AlbTextEditorSelectionHandler new }
 ]
 
-{ #category : 'shortcut management' }
+{ #category : #'shortcut management' }
 AlbEditableMode >> defaultShortcuts [
 
 	^ { 
@@ -58,13 +56,13 @@ AlbEditableMode >> defaultShortcuts [
 		  AlbEditorSelectLineAboveCursorShortcut new }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditableMode >> defaultWordStencil [ 
 
 	^ AlbTextWordPieceStencil editable
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbEditableMode >> isEditable [
 
 	^ true
diff --git a/src/Album/AlbEditorCarriageReturnShortcut.class.st b/src/Album/AlbEditorCarriageReturnShortcut.class.st
index 4da0ec6..fec20c5 100644
--- a/src/Album/AlbEditorCarriageReturnShortcut.class.st
+++ b/src/Album/AlbEditorCarriageReturnShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorCarriageReturnShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorCarriageReturnShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorCarriageReturnShortcut >> description [
 	^ 'Inserts a carriage return (cr) at the cursor location and indents the new line to match the indentation of the previous line.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorCarriageReturnShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination return
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorCarriageReturnShortcut >> name [
 	^ 'Insert carriage return'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorCarriageReturnShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor inserter
diff --git a/src/Album/AlbEditorCopyShortcut.class.st b/src/Album/AlbEditorCopyShortcut.class.st
index 780964d..22e6644 100644
--- a/src/Album/AlbEditorCopyShortcut.class.st
+++ b/src/Album/AlbEditorCopyShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorCopyShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorCopyShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorCopyShortcut >> description [
 	^ 'Copies the selection text into the clipboard.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorCopyShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryC
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorCopyShortcut >> name [
 	^ 'Copy'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorCopyShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor copySelected
diff --git a/src/Album/AlbEditorCutShortcut.class.st b/src/Album/AlbEditorCutShortcut.class.st
index 7f098f1..478f68a 100644
--- a/src/Album/AlbEditorCutShortcut.class.st
+++ b/src/Album/AlbEditorCutShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorCutShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorCutShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorCutShortcut >> description [
 	^ 'Cut selected text and save it to the clipboard ready to paste elsewhere.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorCutShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryX
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorCutShortcut >> name [
 	^ 'Cut'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorCutShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor cutSelected
diff --git a/src/Album/AlbEditorDeleteOneLetterAfterCursorShortcut.class.st b/src/Album/AlbEditorDeleteOneLetterAfterCursorShortcut.class.st
index 94e754c..ec13efc 100644
--- a/src/Album/AlbEditorDeleteOneLetterAfterCursorShortcut.class.st
+++ b/src/Album/AlbEditorDeleteOneLetterAfterCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorDeleteOneLetterAfterCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorDeleteOneLetterAfterCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeleteOneLetterAfterCursorShortcut >> description [
 	^ 'Discards the character ahead of the cursor''s position, moving all following characters one position "back" towards the freed letterspace.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorDeleteOneLetterAfterCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination delete
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeleteOneLetterAfterCursorShortcut >> name [
 	^ 'Forward delete'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorDeleteOneLetterAfterCursorShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deleter
diff --git a/src/Album/AlbEditorDeleteOneLetterBeforeCursorShortcut.class.st b/src/Album/AlbEditorDeleteOneLetterBeforeCursorShortcut.class.st
index 8d0a81d..ee20420 100644
--- a/src/Album/AlbEditorDeleteOneLetterBeforeCursorShortcut.class.st
+++ b/src/Album/AlbEditorDeleteOneLetterBeforeCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorDeleteOneLetterBeforeCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorDeleteOneLetterBeforeCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeleteOneLetterBeforeCursorShortcut >> description [
 	^ 'Moves the display cursor one position backwards, deletes the character at that position, and shifts back the text after that position by one position.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorDeleteOneLetterBeforeCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination backspace
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeleteOneLetterBeforeCursorShortcut >> name [
 	^ 'Delete'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorDeleteOneLetterBeforeCursorShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deleter
diff --git a/src/Album/AlbEditorDeselectAllShortcut.class.st b/src/Album/AlbEditorDeselectAllShortcut.class.st
index d83468b..0343ac4 100644
--- a/src/Album/AlbEditorDeselectAllShortcut.class.st
+++ b/src/Album/AlbEditorDeselectAllShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorDeselectAllShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorDeselectAllShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeselectAllShortcut >> description [
 	^ 'Deselects any currently selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorDeselectAllShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination escape
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorDeselectAllShortcut >> name [
 	^ 'Deselect'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorDeselectAllShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor selectNone
diff --git a/src/Album/AlbEditorElement.class.st b/src/Album/AlbEditorElement.class.st
index 25c99d9..e36beec 100644
--- a/src/Album/AlbEditorElement.class.st
+++ b/src/Album/AlbEditorElement.class.st
@@ -5,8 +5,8 @@ Text editing operations are driven by my data source (called textEditor). I also
 
 "
 Class {
-	#name : 'AlbEditorElement',
-	#superclass : 'BlElement',
+	#name : #AlbEditorElement,
+	#superclass : #BlElement,
 	#traits : 'TAlbInfiniteDecorator + TBlLayoutResizable',
 	#classTraits : 'TAlbInfiniteDecorator classTrait + TBlLayoutResizable classTrait',
 	#instVars : [
@@ -14,18 +14,16 @@ Class {
 		'modeEventHandlers',
 		'frontLayer'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultBackground [
 
 	^ BlBackground paint: Color white
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultFrontLayer [
 
 	| layer |
@@ -38,45 +36,45 @@ self flag: 'Check elevation use'.
 	^ layer
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultInfiniteElement [  
 
 	^ AlbInfiniteEditorElement new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultLayout [
 
 	^ BlFrameLayout new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultMargin [
 
 	^ BlInsets empty
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultModeEventHandlers [
 
 	^ self mode defaultFrontLayerEventHandlers.
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> defaultPadding [
 
 	^ BlInsets empty
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorElement >> frontLayer [
 
 	^ frontLayer
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> initialize [
 
 	| distributor |
@@ -110,7 +108,7 @@ AlbEditorElement >> initialize [
 	self installModeEventHandlers
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> installModeEventHandlers [
 
 	self modeEventHandlersDo: [ :e | self removeEventHandler: e ].
@@ -122,25 +120,25 @@ AlbEditorElement >> installModeEventHandlers [
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> installPrimarySelectionElement [
 
 	(self mode primarySelectionElementIn: self) ifNotNil: [ :s | s onInstalled]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> installRemanentUpdater [
 
 	AlbRemanentsUpdater new onInstalledIn: self
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> modeEventHandlersDo: aBlock [
 
 	modeEventHandlers ifNotNil: [ modeEventHandlers do: aBlock ]
 ]
 
-{ #category : 't  - layout resizeable' }
+{ #category : #'t  - layout resizeable' }
 AlbEditorElement >> resizableConstraintsDo: aBlock [
 	"Perform aBlock with my constraints as argument.
 	Note: After evaluation I request a layout update!
@@ -156,7 +154,7 @@ AlbEditorElement >> resizableConstraintsDo: aBlock [
 	self constraintsDo: aBlock
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorElement >> selectionColor [
 
 	^  (Color
diff --git a/src/Album/AlbEditorElementHandler.class.st b/src/Album/AlbEditorElementHandler.class.st
index c4b7e44..a01102c 100644
--- a/src/Album/AlbEditorElementHandler.class.st
+++ b/src/Album/AlbEditorElementHandler.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbEditorElementHandler',
-	#superclass : 'BlCustomEventHandler',
+	#name : #AlbEditorElementHandler,
+	#superclass : #BlCustomEventHandler,
 	#instVars : [
 		'element'
 	],
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorElementHandler >> element: anElement [
 
 	element := anElement
diff --git a/src/Album/AlbEditorFocusNextShortcut.class.st b/src/Album/AlbEditorFocusNextShortcut.class.st
index a95ccd5..e4d0487 100644
--- a/src/Album/AlbEditorFocusNextShortcut.class.st
+++ b/src/Album/AlbEditorFocusNextShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorFocusNextShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorFocusNextShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorFocusNextShortcut >> description [
 	^ 'Gives focus to the next focusable element.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorFocusNextShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowRight
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorFocusNextShortcut >> name [
 	^ 'Focus next'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorFocusNextShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aEditorElement
diff --git a/src/Album/AlbEditorFocusPreviousShortcut.class.st b/src/Album/AlbEditorFocusPreviousShortcut.class.st
index a057811..09fa94a 100644
--- a/src/Album/AlbEditorFocusPreviousShortcut.class.st
+++ b/src/Album/AlbEditorFocusPreviousShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorFocusPreviousShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorFocusPreviousShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorFocusPreviousShortcut >> description [
 	^ 'Gives focus to the previous focusable element.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorFocusPreviousShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowLeft
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorFocusPreviousShortcut >> name [
 	^ 'Focus previous'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorFocusPreviousShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aEditorElement
diff --git a/src/Album/AlbEditorLineEndingShortcut.class.st b/src/Album/AlbEditorLineEndingShortcut.class.st
index 566a457..eb599d0 100644
--- a/src/Album/AlbEditorLineEndingShortcut.class.st
+++ b/src/Album/AlbEditorLineEndingShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorLineEndingShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorLineEndingShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorLineEndingShortcut >> description [
 	^ 'Inserts a platform specific line ending at the cursor location and indents the new line to match the indentation of the previous line.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorLineEndingShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination return
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorLineEndingShortcut >> name [
 	^ 'Insert line ending'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorLineEndingShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor inserter
diff --git a/src/Album/AlbEditorLoseFocusShortcut.class.st b/src/Album/AlbEditorLoseFocusShortcut.class.st
index 6814250..a1bcd5b 100644
--- a/src/Album/AlbEditorLoseFocusShortcut.class.st
+++ b/src/Album/AlbEditorLoseFocusShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorLoseFocusShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorLoseFocusShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorLoseFocusShortcut >> description [
 	^ 'Loses focus.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorLoseFocusShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination escape
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorLoseFocusShortcut >> name [
 	^ 'Lose focus'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorLoseFocusShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aEditorElement loseFocus
 ]
diff --git a/src/Album/AlbEditorMoveCursorDownShortcut.class.st b/src/Album/AlbEditorMoveCursorDownShortcut.class.st
index a0c55d8..d13d85e 100644
--- a/src/Album/AlbEditorMoveCursorDownShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorDownShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorMoveCursorDownShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorDownShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorDownShortcut >> description [
 	^ 'Moves the cursor one line at a time below the current position and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorDownShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowDown
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorDownShortcut >> name [
 	^ 'Move cursor down'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorDownShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 
diff --git a/src/Album/AlbEditorMoveCursorLeftShortcut.class.st b/src/Album/AlbEditorMoveCursorLeftShortcut.class.st
index 137c4c4..2537fb3 100644
--- a/src/Album/AlbEditorMoveCursorLeftShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorLeftShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorMoveCursorLeftShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorLeftShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorLeftShortcut >> description [
 	^ 'Moves the cursor one letter at a time to the left from the current position and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorLeftShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowLeft
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorLeftShortcut >> name [
 	^ 'Move cursor left'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorLeftShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 
diff --git a/src/Album/AlbEditorMoveCursorRightShortcut.class.st b/src/Album/AlbEditorMoveCursorRightShortcut.class.st
index c005a19..3be7ca4 100644
--- a/src/Album/AlbEditorMoveCursorRightShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorRightShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorMoveCursorRightShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorRightShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorRightShortcut >> description [
 	^ 'Moves the cursor one letter at a time to the right from the current position and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorRightShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowRight
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorRightShortcut >> name [
 	^ 'Move cursor right'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorRightShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 
diff --git a/src/Album/AlbEditorMoveCursorToLineEndShortcut.class.st b/src/Album/AlbEditorMoveCursorToLineEndShortcut.class.st
index da9d218..010aeae 100644
--- a/src/Album/AlbEditorMoveCursorToLineEndShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorToLineEndShortcut.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbEditorMoveCursorToLineEndShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorToLineEndShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToLineEndShortcut >> description [
 	^ 'Moves the cursor to the end of the current line and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorToLineEndShortcut >> initialize [
 	super initialize.
 	
@@ -19,12 +17,12 @@ AlbEditorMoveCursorToLineEndShortcut >> initialize [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToLineEndShortcut >> name [
 	^ 'Move cursor to the line end'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorToLineEndShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deselecter
diff --git a/src/Album/AlbEditorMoveCursorToLineStartShortcut.class.st b/src/Album/AlbEditorMoveCursorToLineStartShortcut.class.st
index 81c27dc..da45609 100644
--- a/src/Album/AlbEditorMoveCursorToLineStartShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorToLineStartShortcut.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbEditorMoveCursorToLineStartShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorToLineStartShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToLineStartShortcut >> description [
 	^ 'Moves the cursor to the start of the current line and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorToLineStartShortcut >> initialize [
 	super initialize.
 	
@@ -19,12 +17,12 @@ AlbEditorMoveCursorToLineStartShortcut >> initialize [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToLineStartShortcut >> name [
 	^ 'Move cursor to the line start'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorToLineStartShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deselecter
diff --git a/src/Album/AlbEditorMoveCursorToNextWordShortcut.class.st b/src/Album/AlbEditorMoveCursorToNextWordShortcut.class.st
index 23e28ae..bc1c506 100644
--- a/src/Album/AlbEditorMoveCursorToNextWordShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorToNextWordShortcut.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbEditorMoveCursorToNextWordShortcut',
-	#superclass : 'AlbEditorShortcut',
+	#name : #AlbEditorMoveCursorToNextWordShortcut,
+	#superclass : #AlbEditorShortcut,
 	#instVars : [
 		'combinationForMacOS'
 	],
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'api - combination' }
+{ #category : #'api - combination' }
 AlbEditorMoveCursorToNextWordShortcut >> combinationForMacOS [
 	^ combinationForMacOS
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToNextWordShortcut >> description [
 	^ 'Moves the cursor to the end of the next (or current) word and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorToNextWordShortcut >> initialize [
 	super initialize.
 	
@@ -27,12 +25,12 @@ AlbEditorMoveCursorToNextWordShortcut >> initialize [
 	combinationForMacOS := BlKeyCombination builder alt arrowRight build.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToNextWordShortcut >> name [
 	^ 'Move cursor to the next word'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorToNextWordShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deselecter
diff --git a/src/Album/AlbEditorMoveCursorToPreviousWordShortcut.class.st b/src/Album/AlbEditorMoveCursorToPreviousWordShortcut.class.st
index b454246..56a0a7e 100644
--- a/src/Album/AlbEditorMoveCursorToPreviousWordShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorToPreviousWordShortcut.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbEditorMoveCursorToPreviousWordShortcut',
-	#superclass : 'AlbEditorShortcut',
+	#name : #AlbEditorMoveCursorToPreviousWordShortcut,
+	#superclass : #AlbEditorShortcut,
 	#instVars : [
 		'combinationForMacOS'
 	],
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'api - combination' }
+{ #category : #'api - combination' }
 AlbEditorMoveCursorToPreviousWordShortcut >> combinationForMacOS [
 	^ combinationForMacOS
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToPreviousWordShortcut >> description [
 	^ 'Moves the cursor to the start of the previous (or current) word and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorToPreviousWordShortcut >> initialize [
 	super initialize.
 
@@ -27,12 +25,12 @@ AlbEditorMoveCursorToPreviousWordShortcut >> initialize [
 	combinationForMacOS := BlKeyCombination builder alt arrowLeft build.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorToPreviousWordShortcut >> name [
 	^ 'Move cursor to the previous word'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorToPreviousWordShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deselecter
diff --git a/src/Album/AlbEditorMoveCursorUpShortcut.class.st b/src/Album/AlbEditorMoveCursorUpShortcut.class.st
index b31e905..7cd1afb 100644
--- a/src/Album/AlbEditorMoveCursorUpShortcut.class.st
+++ b/src/Album/AlbEditorMoveCursorUpShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorMoveCursorUpShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorMoveCursorUpShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorUpShortcut >> description [
 	^ 'Moves the cursor one line at a time above the current position and deselects any selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorMoveCursorUpShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination arrowUp
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorMoveCursorUpShortcut >> name [
 	^ 'Move cursor up'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorMoveCursorUpShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor deselecter
diff --git a/src/Album/AlbEditorPasteShortcut.class.st b/src/Album/AlbEditorPasteShortcut.class.st
index 165c8ec..b1bd77c 100644
--- a/src/Album/AlbEditorPasteShortcut.class.st
+++ b/src/Album/AlbEditorPasteShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorPasteShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorPasteShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorPasteShortcut >> description [
 	^ 'Paste a text from the clipboard at the current cursor position and delete any currently selected text.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorPasteShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryV
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorPasteShortcut >> name [
 	^ 'Paste'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorPasteShortcut >> performOnEditor: aTextEditor element: anEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor paster
diff --git a/src/Album/AlbEditorRedoShortcut.class.st b/src/Album/AlbEditorRedoShortcut.class.st
index e51a6c5..ae88fff 100644
--- a/src/Album/AlbEditorRedoShortcut.class.st
+++ b/src/Album/AlbEditorRedoShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorRedoShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorRedoShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorRedoShortcut >> description [
 	^ 'Reverses the undo or advances the document to a more recent state.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorRedoShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryShiftZ
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorRedoShortcut >> name [
 	^ 'Redo'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorRedoShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor redo
diff --git a/src/Album/AlbEditorSegmentHolder.class.st b/src/Album/AlbEditorSegmentHolder.class.st
index 4c92137..e54a656 100644
--- a/src/Album/AlbEditorSegmentHolder.class.st
+++ b/src/Album/AlbEditorSegmentHolder.class.st
@@ -3,14 +3,12 @@ I am a segment holder and is responsible for binding it to its visual representa
 I am also responsible for caching functionality in order to reduce amount of instantiated objects.
 "
 Class {
-	#name : 'AlbEditorSegmentHolder',
-	#superclass : 'BlInfiniteHolder',
-	#category : 'Album-Model-Segment',
-	#package : 'Album',
-	#tag : 'Model-Segment'
+	#name : #AlbEditorSegmentHolder,
+	#superclass : #BlInfiniteHolder,
+	#category : 'Album-Model-Segment'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSegmentHolder >> createSegmentElement [
 	"Create and return an that should represent a segment that I will hold.
 	An element can be any of `BlElement withAllSubclasses`"
@@ -19,7 +17,7 @@ AlbEditorSegmentHolder >> createSegmentElement [
 	^ self subclassResponsibility
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentHolder >> editor [
 	"Return the attached text editor instance.
 	Editor can not be nil"
@@ -28,14 +26,14 @@ AlbEditorSegmentHolder >> editor [
 	^ self infiniteElement editor
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSegmentHolder >> initialize [
 	super initialize.
 
 	itemElement := self createSegmentElement
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbEditorSegmentHolder >> onCursorAdded [
 	"Is sent when text editor's cursor changes.
 	Segment holder should update text elements accordingly"
@@ -43,7 +41,7 @@ AlbEditorSegmentHolder >> onCursorAdded [
 	self subclassResponsibility
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbEditorSegmentHolder >> onCursorRemoved [
 	"Is sent when text editor's cursor changes.
 	Segment holder should update text elements accordingly"
@@ -51,7 +49,7 @@ AlbEditorSegmentHolder >> onCursorRemoved [
 	self subclassResponsibility
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbEditorSegmentHolder >> onFocusChanged: aBoolean [
 	"Is sent when text editor's focus state changes.
 	Segment holder should update text elements accordingly"
@@ -59,7 +57,7 @@ AlbEditorSegmentHolder >> onFocusChanged: aBoolean [
 	self subclassResponsibility
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbEditorSegmentHolder >> onSelectionChanged [
 	"Is sent when text editor's selection changes.
 	Segment holder should update text elements accordingly"
@@ -67,7 +65,7 @@ AlbEditorSegmentHolder >> onSelectionChanged [
 	self subclassResponsibility
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbEditorSegmentHolder >> onTextChanged [
 	"Is sent when text changed in the editor (for example style attributes).
 	Segment holder should update text elements accordingly"
@@ -75,7 +73,7 @@ AlbEditorSegmentHolder >> onTextChanged [
 	self subclassResponsibility
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentHolder >> segment: aEditorSegment [
 
 	^ self subclassResponsibility
diff --git a/src/Album/AlbEditorSegmentStream.class.st b/src/Album/AlbEditorSegmentStream.class.st
index dc8922c..6cd186e 100644
--- a/src/Album/AlbEditorSegmentStream.class.st
+++ b/src/Album/AlbEditorSegmentStream.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbEditorSegmentStream',
-	#superclass : 'Object',
+	#name : #AlbEditorSegmentStream,
+	#superclass : #Object,
 	#traits : 'TBlDebug',
 	#classTraits : 'TBlDebug classTrait',
 	#instVars : [
@@ -8,30 +8,28 @@ Class {
 		'skip',
 		'stream'
 	],
-	#category : 'Album-Model-Segment',
-	#package : 'Album',
-	#tag : 'Model-Segment'
+	#category : 'Album-Model-Segment'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> collection [
 
 	^ stream contents 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> collection: anObject [
 	stream reset.
 	stream nextPutAll: anObject
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSegmentStream >> defaultLimit [
 
 	^ 500
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSegmentStream >> initialize [
 	super initialize.
 	
@@ -40,17 +38,17 @@ AlbEditorSegmentStream >> initialize [
 	skip := 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> limit [
 	^ limit
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> limit: aNumber [
 	limit := aNumber
 ]
 
-{ #category : 'streaming' }
+{ #category : #streaming }
 AlbEditorSegmentStream >> nextPut: aTextEditorSegment [
 	self
 		assert: [ self wantsMore ]
@@ -61,7 +59,7 @@ AlbEditorSegmentStream >> nextPut: aTextEditorSegment [
 		ifFalse: [ skip := skip - 1 ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> rawSegments [
 	"Return a collection of streamed text segments.
 	I am an alias to #originalContents allowing us to increase readability BUT you must known what you are doing because returning such an internal state for optimization purpose can have bad effects..."
@@ -71,7 +69,7 @@ AlbEditorSegmentStream >> rawSegments [
 	^ stream originalContents
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> segments [
 	"Return a collection of streamed text segments."
 	
@@ -80,17 +78,17 @@ AlbEditorSegmentStream >> segments [
 	^ self collection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> size [
 	^ stream size
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> skip [
 	^ skip
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSegmentStream >> skip: aNumber [
 
 	self
@@ -103,12 +101,12 @@ AlbEditorSegmentStream >> skip: aNumber [
 	skip := aNumber
 ]
 
-{ #category : 'streaming' }
+{ #category : #streaming }
 AlbEditorSegmentStream >> unlimited [
 	limit := -1
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbEditorSegmentStream >> wantsMore [
 	^ limit < 0 or: [self size < limit]
 ]
diff --git a/src/Album/AlbEditorSelectAllShortcut.class.st b/src/Album/AlbEditorSelectAllShortcut.class.st
index 04cef1e..bc1e314 100644
--- a/src/Album/AlbEditorSelectAllShortcut.class.st
+++ b/src/Album/AlbEditorSelectAllShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorSelectAllShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectAllShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectAllShortcut >> description [
 	^ 'Selects all text'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectAllShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryA
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectAllShortcut >> name [
 	^ 'Select all'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectAllShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor selecter
diff --git a/src/Album/AlbEditorSelectLetterAfterCursorShortcut.class.st b/src/Album/AlbEditorSelectLetterAfterCursorShortcut.class.st
index 4a3c747..a7662d6 100644
--- a/src/Album/AlbEditorSelectLetterAfterCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLetterAfterCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorSelectLetterAfterCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLetterAfterCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLetterAfterCursorShortcut >> description [
 	^ 'Selects one letter at a time to the right from the cursor.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLetterAfterCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination shiftArrowRight
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLetterAfterCursorShortcut >> name [
 	^ 'Select letter to the right'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLetterAfterCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		moveOneToRight;
diff --git a/src/Album/AlbEditorSelectLetterBeforeCursorShortcut.class.st b/src/Album/AlbEditorSelectLetterBeforeCursorShortcut.class.st
index fac5ef1..6f098d0 100644
--- a/src/Album/AlbEditorSelectLetterBeforeCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLetterBeforeCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorSelectLetterBeforeCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLetterBeforeCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLetterBeforeCursorShortcut >> description [
 	^ 'Selects one letter at a time to the left from the cursor.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLetterBeforeCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination shiftArrowLeft
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLetterBeforeCursorShortcut >> name [
 	^ 'Select letter to the left'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLetterBeforeCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		moveOneToLeft;
diff --git a/src/Album/AlbEditorSelectLineAboveCursorShortcut.class.st b/src/Album/AlbEditorSelectLineAboveCursorShortcut.class.st
index 26461ed..8a57948 100644
--- a/src/Album/AlbEditorSelectLineAboveCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLineAboveCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorSelectLineAboveCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLineAboveCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineAboveCursorShortcut >> description [
 	^ 'Selects one line at a time above the cursor.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLineAboveCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination shiftArrowUp
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineAboveCursorShortcut >> name [
 	^ 'Select line above'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLineAboveCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		moveOneUp;
diff --git a/src/Album/AlbEditorSelectLineAfterCursorShortcut.class.st b/src/Album/AlbEditorSelectLineAfterCursorShortcut.class.st
index 8536003..8f87edf 100644
--- a/src/Album/AlbEditorSelectLineAfterCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLineAfterCursorShortcut.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbEditorSelectLineAfterCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLineAfterCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineAfterCursorShortcut >> description [
 	^ 'Extends the selection from the current cursor position to the end of a line.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLineAfterCursorShortcut >> initialize [
 	super initialize.
 	
@@ -19,12 +17,12 @@ AlbEditorSelectLineAfterCursorShortcut >> initialize [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineAfterCursorShortcut >> name [
 	^ 'Select to the end of a line'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLineAfterCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		extendToLineEnd;
diff --git a/src/Album/AlbEditorSelectLineBeforeCursorShortcut.class.st b/src/Album/AlbEditorSelectLineBeforeCursorShortcut.class.st
index ae9995b..df569b6 100644
--- a/src/Album/AlbEditorSelectLineBeforeCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLineBeforeCursorShortcut.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbEditorSelectLineBeforeCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLineBeforeCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineBeforeCursorShortcut >> description [
 	^ 'Extends the selection from the current cursor position to the beginning of a line.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLineBeforeCursorShortcut >> initialize [
 	super initialize.
 	
@@ -19,12 +17,12 @@ AlbEditorSelectLineBeforeCursorShortcut >> initialize [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineBeforeCursorShortcut >> name [
 	^ 'Select to the beginning of a line'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLineBeforeCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		extendToLineStart;
diff --git a/src/Album/AlbEditorSelectLineBelowCursorShortcut.class.st b/src/Album/AlbEditorSelectLineBelowCursorShortcut.class.st
index df7962e..00443c9 100644
--- a/src/Album/AlbEditorSelectLineBelowCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectLineBelowCursorShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorSelectLineBelowCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorSelectLineBelowCursorShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineBelowCursorShortcut >> description [
 	^ 'Selects one line at a time below the cursor.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectLineBelowCursorShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination shiftArrowDown
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectLineBelowCursorShortcut >> name [
 	^ 'Select line below'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectLineBelowCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		moveOneDown;
diff --git a/src/Album/AlbEditorSelectWordAfterCursorShortcut.class.st b/src/Album/AlbEditorSelectWordAfterCursorShortcut.class.st
index d0dac05..db119f6 100644
--- a/src/Album/AlbEditorSelectWordAfterCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectWordAfterCursorShortcut.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbEditorSelectWordAfterCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
+	#name : #AlbEditorSelectWordAfterCursorShortcut,
+	#superclass : #AlbEditorShortcut,
 	#instVars : [
 		'combinationForMacOS'
 	],
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'api - combination' }
+{ #category : #'api - combination' }
 AlbEditorSelectWordAfterCursorShortcut >> combinationForMacOS [
 	^ combinationForMacOS
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectWordAfterCursorShortcut >> description [
 	^ 'Extends the selection from the current cursor position to the end of the next word.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectWordAfterCursorShortcut >> initialize [
 	super initialize.
 	
@@ -27,12 +25,12 @@ AlbEditorSelectWordAfterCursorShortcut >> initialize [
 	combinationForMacOS := BlKeyCombination builder shift alt arrowRight build.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectWordAfterCursorShortcut >> name [
 	^ 'Select next word'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectWordAfterCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		extendToNextWordEnd;
diff --git a/src/Album/AlbEditorSelectWordBeforeCursorShortcut.class.st b/src/Album/AlbEditorSelectWordBeforeCursorShortcut.class.st
index aaddc5a..8e6ebd3 100644
--- a/src/Album/AlbEditorSelectWordBeforeCursorShortcut.class.st
+++ b/src/Album/AlbEditorSelectWordBeforeCursorShortcut.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbEditorSelectWordBeforeCursorShortcut',
-	#superclass : 'AlbEditorShortcut',
+	#name : #AlbEditorSelectWordBeforeCursorShortcut,
+	#superclass : #AlbEditorShortcut,
 	#instVars : [
 		'combinationForMacOS'
 	],
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'api - combination' }
+{ #category : #'api - combination' }
 AlbEditorSelectWordBeforeCursorShortcut >> combinationForMacOS [
 	^ combinationForMacOS
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectWordBeforeCursorShortcut >> description [
 	^ 'Extends the selection from the current cursor position to the beginning of previous word.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorSelectWordBeforeCursorShortcut >> initialize [
 	super initialize.
 	
@@ -27,12 +25,12 @@ AlbEditorSelectWordBeforeCursorShortcut >> initialize [
 	combinationForMacOS := BlKeyCombination builder shift alt arrowLeft build.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorSelectWordBeforeCursorShortcut >> name [
 	^ 'Select previous word'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorSelectWordBeforeCursorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	aTextEditor selecter
 		extendToPreviousWordStart;
diff --git a/src/Album/AlbEditorShiftRightShortcut.class.st b/src/Album/AlbEditorShiftRightShortcut.class.st
index 6e98b2a..6f9c521 100644
--- a/src/Album/AlbEditorShiftRightShortcut.class.st
+++ b/src/Album/AlbEditorShiftRightShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorShiftRightShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorShiftRightShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShiftRightShortcut >> description [
 	^ 'Shift text at the cursor or if there is selection, the selected lines, one indetation to the right.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorShiftRightShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination tab
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorShiftRightShortcut >> name [
 	^ 'Shift right'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorShiftRightShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor selection isEmpty
diff --git a/src/Album/AlbEditorShortcut.class.st b/src/Album/AlbEditorShortcut.class.st
index 36115f4..f116657 100644
--- a/src/Album/AlbEditorShortcut.class.st
+++ b/src/Album/AlbEditorShortcut.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbEditorShortcut',
-	#superclass : 'BlBasicShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorShortcut,
+	#superclass : #BlBasicShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorShortcut >> performDueTo: aShortcutEvent [
 
 	"we consume shortcut event before evaluating a custom action in order to give subclasses a chance to not consume the event"
@@ -18,7 +16,7 @@ AlbEditorShortcut >> performDueTo: aShortcutEvent [
 		dueTo: aShortcutEvent
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 	self subclassResponsibility
 ]
diff --git a/src/Album/AlbEditorUndoShortcut.class.st b/src/Album/AlbEditorUndoShortcut.class.st
index 3f997df..43ed344 100644
--- a/src/Album/AlbEditorUndoShortcut.class.st
+++ b/src/Album/AlbEditorUndoShortcut.class.st
@@ -1,29 +1,27 @@
 Class {
-	#name : 'AlbEditorUndoShortcut',
-	#superclass : 'AlbEditorShortcut',
-	#category : 'Album-Shortcuts',
-	#package : 'Album',
-	#tag : 'Shortcuts'
+	#name : #AlbEditorUndoShortcut,
+	#superclass : #AlbEditorShortcut,
+	#category : 'Album-Shortcuts'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorUndoShortcut >> description [
 	^ 'Erases the last change done to the document, reverting it to an older state.'
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbEditorUndoShortcut >> initialize [
 	super initialize.
 	
 	combination := BlKeyCombination primaryZ
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbEditorUndoShortcut >> name [
 	^ 'Undo'
 ]
 
-{ #category : 'evaluation' }
+{ #category : #evaluation }
 AlbEditorUndoShortcut >> performOnEditor: aTextEditor element: aEditorElement dueTo: aShortcutEvent [
 
 	aTextEditor undo
diff --git a/src/Album/AlbEditorWrongThreadError.class.st b/src/Album/AlbEditorWrongThreadError.class.st
index f7123b6..42a2138 100644
--- a/src/Album/AlbEditorWrongThreadError.class.st
+++ b/src/Album/AlbEditorWrongThreadError.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbEditorWrongThreadError',
-	#superclass : 'Error',
-	#category : 'Album-Errors',
-	#package : 'Album',
-	#tag : 'Errors'
+	#name : #AlbEditorWrongThreadError,
+	#superclass : #Error,
+	#category : 'Album-Errors'
 }
diff --git a/src/Album/AlbExtendSelectionCommand.class.st b/src/Album/AlbExtendSelectionCommand.class.st
index 417f265..37dba4b 100644
--- a/src/Album/AlbExtendSelectionCommand.class.st
+++ b/src/Album/AlbExtendSelectionCommand.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbExtendSelectionCommand',
-	#superclass : 'Object',
+	#name : #AlbExtendSelectionCommand,
+	#superclass : #Object,
 	#instVars : [
 		'editor',
 		'toSelect',
@@ -10,17 +10,15 @@ Class {
 		'shouldResetDesiredCoordinate',
 		'toRemoveCursors'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> editor: anEditor [
 	editor := anEditor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> initialize [
 	super initialize.
 
@@ -32,64 +30,64 @@ AlbExtendSelectionCommand >> initialize [
 	shouldResetDesiredCoordinate := true
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> shouldResetDesiredCoordinate [
 	^ shouldResetDesiredCoordinate
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbExtendSelectionCommand >> toAddCursor: aPosition [
 	toAddCursor := aPosition
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbExtendSelectionCommand >> toAddCursorDo: aBlock [
 	toAddCursor ifNotNil: [ :aPosition | aBlock value: aPosition ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toDeselect [
 
 	^ toDeselect
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toDeselect: aCollection [
 	toDeselect := aCollection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toDeselectDo: aBlockWithOneArgument [
 	toDeselect do: aBlockWithOneArgument
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbExtendSelectionCommand >> toMoveCursor: aCursor by: anAmount [
 	toMoveCursor := aCursor -> anAmount
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbExtendSelectionCommand >> toMoveCursorDo: aBlock [
 	toMoveCursor ifNotNil: [ :anAssociation |
 		aBlock value: anAssociation key value: anAssociation value ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toSelect [
 	^ toSelect
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toSelect: aCollection [
 	toSelect := aCollection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> toSelectDo: aBlockWithOneArgument [
 	toSelect do: aBlockWithOneArgument
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbExtendSelectionCommand >> withoutResettingDesiredCoordinate [
 	shouldResetDesiredCoordinate := false
 ]
diff --git a/src/Album/AlbFlowLine.class.st b/src/Album/AlbFlowLine.class.st
index cb32539..f0cb4c0 100644
--- a/src/Album/AlbFlowLine.class.st
+++ b/src/Album/AlbFlowLine.class.st
@@ -4,8 +4,8 @@ I represent a single line of a flow layout.
 I store reference to the next line in order to avoid unnecessary array of lines creation for a very common case of just one line
 "
 Class {
-	#name : 'AlbFlowLine',
-	#superclass : 'Object',
+	#name : #AlbFlowLine,
+	#superclass : #Object,
 	#instVars : [
 		'elements',
 		'maxWidth',
@@ -17,12 +17,10 @@ Class {
 		'origin',
 		'baseline'
 	],
-	#category : 'Album-Layout',
-	#package : 'Album',
-	#tag : 'Layout'
+	#category : 'Album-Layout'
 }
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbFlowLine >> add: anElement [
 
 	"Try to assign a given element to this line (if possible) or create a new line.
@@ -44,12 +42,12 @@ AlbFlowLine >> add: anElement [
 		  ifFalse: [ currentLine ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> baseline [
 	^ baseline
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> count [
 	"Return how many lines there are in total"
 	<return: #Number>
@@ -59,7 +57,7 @@ AlbFlowLine >> count [
 		ifFalse: [ 0 ])
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> distanceTo: aPoint [
 	"Compute the vertical distance from me to a given point"
 	<return: #Number>
@@ -70,7 +68,7 @@ AlbFlowLine >> distanceTo: aPoint [
 	^ (aPoint y - aClampedCoordinate) abs
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbFlowLine >> do: aBlock [
 	"Evaluate aBlock with each of my next lines as the argument"
 
@@ -79,7 +77,7 @@ AlbFlowLine >> do: aBlock [
 		ifTrue: [ nextLine do: aBlock ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> elements [
 	"Return a collection of all elements assigned to this line"
 	<return: #OrderedCollection>
@@ -87,7 +85,7 @@ AlbFlowLine >> elements [
 	^ elements
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> elementsIn: anElement [
 	"Return a collection of all elements assigned to this line"
 	<return: #OrderedCollection>
@@ -95,7 +93,7 @@ AlbFlowLine >> elementsIn: anElement [
 	^ elements ifNil: [ elements := anElement children select: [ :eachChild | eachChild constraints albumTextFlow assignedLine = self ] ]
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> findClosestChildOf: anElement to: aPoint [
 	<return: #BlElement>
 	
@@ -109,7 +107,7 @@ AlbFlowLine >> findClosestChildOf: anElement to: aPoint [
 		in: (anElement children select: [ :eachChild | eachChild constraints albumTextFlow assignedLine = self ])
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> findClosestElementTo: aPoint in: aCollectionOfElements [
 	<return: #BlElement>
 	| aClosestElement aClosestDistance |
@@ -129,7 +127,7 @@ AlbFlowLine >> findClosestElementTo: aPoint in: aCollectionOfElements [
 	^ aClosestElement
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbFlowLine >> hasNextLine [
 	"Return true if there is a next line, false otherwise"
 	<return: #Boolean>
@@ -137,7 +135,7 @@ AlbFlowLine >> hasNextLine [
 	^ nextLine isNotNil
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbFlowLine >> hasSpaceFor: anElement [
 	"Return true if I am able to provide space for a given element.
 	By convention I always allow element to take space if I am empty
@@ -156,7 +154,7 @@ AlbFlowLine >> hasSpaceFor: anElement [
 			ifFalse: [ availableWidth closeTo: aChildWidth epsilon: 0.5 ] ]
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> height [
 	"Return my height which is equal to the height of the highest element"
 	<return: #Number>
@@ -164,7 +162,7 @@ AlbFlowLine >> height [
 	^ height
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbFlowLine >> initialize [
 
 	super initialize.
@@ -180,7 +178,7 @@ AlbFlowLine >> initialize [
 	pushedQueue := LinkedList new
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbFlowLine >> isEmpty [
 	"Return true if I am an empty line without any element, false otherwise"
 	<return: #Boolean>
@@ -188,13 +186,13 @@ AlbFlowLine >> isEmpty [
 	^ elements isEmpty
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbFlowLine >> lastElementDo: aBlock [
 
 	elements ifNotEmpty: [ :theElements | aBlock value: theElements last ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> maxWidth [
 	"Return maximal width limit for the current line"
 	<return: #Number>
@@ -202,7 +200,7 @@ AlbFlowLine >> maxWidth [
 	^ maxWidth
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> maxWidth: aNumber [
 	"Limit maximal width to the given number"
 
@@ -210,7 +208,7 @@ AlbFlowLine >> maxWidth: aNumber [
 	availableWidth := maxWidth - width
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> nextLine [
 	"Return or create a new next line to which we should continue adding elements"
 	<return: #AlbFlowLine>
@@ -222,19 +220,19 @@ AlbFlowLine >> nextLine [
 			yourself ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> origin [
 	<return: #Point>
 
 	^ origin
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> origin: aPoint [
 	origin := aPoint
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbFlowLine >> push: anElement [
 	"Push pushes given element to the end of element's collection
 	and update my geometry properties taking new element into account "
@@ -251,17 +249,17 @@ AlbFlowLine >> push: anElement [
 	baseline := baseline max: (anElement baselineOffset + anElement margin top)
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> pushedQueue [
 	^ pushedQueue
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbFlowLine >> pushedQueue: aQueue [
 	pushedQueue := aQueue
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbFlowLine >> reset [
 	elements := nil.
 	pushedQueue := nil.
@@ -269,7 +267,7 @@ AlbFlowLine >> reset [
 	nextLine ifNotNil: [ :aNextLine | aNextLine reset ]
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> totalHeight [
 	"Return a total height taking into account all next lines"
 	<return: #Number>
@@ -282,7 +280,7 @@ AlbFlowLine >> totalHeight [
 	^ self height + aTotalHeight
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> totalWidth [
 	"Return a total width taking into account all next lines"
 	<return: #Number>
@@ -295,7 +293,7 @@ AlbFlowLine >> totalWidth [
 	^ self width max: aTotalWidth
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbFlowLine >> width [
 	"Return my width which is a sum of widths of all my elements"
 	<return: #Number>
diff --git a/src/Album/AlbInfiniteEditorElement.class.st b/src/Album/AlbInfiniteEditorElement.class.st
index 6a40ef2..9b93fde 100644
--- a/src/Album/AlbInfiniteEditorElement.class.st
+++ b/src/Album/AlbInfiniteEditorElement.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbInfiniteEditorElement',
-	#superclass : 'BlInfiniteElement',
+	#name : #AlbInfiniteEditorElement,
+	#superclass : #BlInfiniteElement,
 	#traits : 'TObservable + TBlLayoutResizable',
 	#classTraits : 'TObservable classTrait + TBlLayoutResizable classTrait',
 	#instVars : [
@@ -10,23 +10,21 @@ Class {
 		'#modeEventHandlers',
 		'#modeShortcuts'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'accessing - editor' }
+{ #category : #'accessing - editor' }
 AlbInfiniteEditorElement >> addEditorShortcut: aTextEditorInteraction [
 
 	self editor addEditorShortcut: aTextEditorInteraction
 ]
 
-{ #category : 'converting' }
+{ #category : #converting }
 AlbInfiniteEditorElement >> asScrollableElement [
 	^ self
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> atTextIndex: aTextIndex do: aBlock [
 
 	" aBlock takes 2 arguments : the local text element and the local text index within the local text element"
@@ -47,160 +45,160 @@ AlbInfiniteEditorElement >> atTextIndex: aTextIndex do: aBlock [
 				 ifAbsent: [ ] ] ]
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> beEditable [
 
 	self mode: AlbEditableMode new
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> beReadonlyWithSelection [
 
 	self mode: AlbReadonlyWithSelectionMode new
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> beReadonlyWithoutSelection [
 
 	self mode: AlbReadonlyWithoutSelectionMode new
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> cacheSize: aNumber [
 	self editor cacheSize: aNumber
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbInfiniteEditorElement >> cursor [
 	^ self editor cursor
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbInfiniteEditorElement >> cursorColor: aColor [
 
 	self cursorStencil cursorColor: aColor
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbInfiniteEditorElement >> cursorElement [
 
 	^ cursorStencil currentCursorElement
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbInfiniteEditorElement >> cursorStencil [
 
 	^ cursorStencil
 ]
 
-{ #category : 'accessing - cursor' }
+{ #category : #'accessing - cursor' }
 AlbInfiniteEditorElement >> cursorStencil: aCursorStencil [
 
 	cursorStencil := aCursorStencil
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> cursors [
 	<return: #AlbTextEditorCursor>
 	^ self editor cursors
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaulTextEditor [
 
 	^ AlbTextEditor new.
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultBackground [
 
 	^ BlBackground paint: Color transparent
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultCursorStencil [
 	
 	^ AlbCursorStencil new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultLayout [
 
 	^ BlInfiniteLinearLayout vertical
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultMargin [
 
 	^ BlInsets empty
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultMode [
 
 	^ AlbEditableMode new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultModeEventHandlers [
 
 	^ self mode defaultEditorElementEventHandlers.
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultModeShortcuts [
 
 	
 	^ self mode ifNil: [ #() ] ifNotNil: [ :m | m defaultShortcuts]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultPadding [
 
 	^ BlInsets empty
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultRecycler [
 
 	^ BlInfiniteRecycler new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultSystemFontName [
 
 	^ 'Source Code Pro'"AeFontManager defaultFontFamilyName"
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> defaultWordStencil [
 
 	^ mode defaultWordStencil
 ]
 
-{ #category : 'editor - operator' }
+{ #category : #'editor - operator' }
 AlbInfiniteEditorElement >> deleter [
 	<return: #AlbTextEditorDeleter>
 
 	^ self editor deleter
 ]
 
-{ #category : 'editor - operator' }
+{ #category : #'editor - operator' }
 AlbInfiniteEditorElement >> deselecter [
 	<return: #AlbTextEditorDeselecter>
 
 	^ self editor deselecter
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> editor [
 	<return: #AlbTextEditor>
 
 	^ self dataSource
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> editor: aTextEditor [
 
 	| prev |
@@ -211,13 +209,13 @@ AlbInfiniteEditorElement >> editor: aTextEditor [
 
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> editorDo: aBlock [
 
 	aBlock value: self editor
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> enlargedSubTextOnScreen [
 	
 	| interval |
@@ -229,7 +227,7 @@ AlbInfiniteEditorElement >> enlargedSubTextOnScreen [
 
 ]
 
-{ #category : 'focus accessing' }
+{ #category : #'focus accessing' }
 AlbInfiniteEditorElement >> focusables: aBlFocusFinderCandidates along: aBlFocusSearchDirection [
 	"Sort candidates according the bounds left, to ensure that rightmost are favored for up and down. "
 
@@ -242,7 +240,7 @@ AlbInfiniteEditorElement >> focusables: aBlFocusFinderCandidates along: aBlFocus
 		a bounds left > b bounds left ]"
 ]
 
-{ #category : 'private - geometry change' }
+{ #category : #'private - geometry change' }
 AlbInfiniteEditorElement >> geometryChanged [
 	"My geometry has possibly changed as a result of extent change, scrolling or layout re-computing"
 	
@@ -255,24 +253,24 @@ AlbInfiniteEditorElement >> geometryChanged [
 		pieceElement positionInEditor: (self localPointToMine: self position fromChild: pieceElement) ]
 ]
 
-{ #category : 'focus testing' }
+{ #category : #'focus testing' }
 AlbInfiniteEditorElement >> hasFocus [
 	^ self editor isFocused
 ]
 
-{ #category : 'accessing - selection' }
+{ #category : #'accessing - selection' }
 AlbInfiniteEditorElement >> hasSelection [
 
 	^ self selection isNotEmpty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbInfiniteEditorElement >> infinite [
 
 	^ self
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteEditorElement >> initialize [
 	
 	self class initializeSlots: self.
@@ -294,33 +292,33 @@ AlbInfiniteEditorElement >> initialize [
 	self elevation: ((BlRelativeElevation elevation: SmallInteger maxVal - 1)).
 ]
 
-{ #category : 'accessing - editor' }
+{ #category : #'accessing - editor' }
 AlbInfiniteEditorElement >> inputFilter: aTextEditorInputFilter [
 
 	self editor inputFilter: aTextEditorInputFilter
 ]
 
-{ #category : 'editor - operator' }
+{ #category : #'editor - operator' }
 AlbInfiniteEditorElement >> inserter [
 	<return: #AlbTextEditorInserter>
 
 	^ self editor inserter
 ]
 
-{ #category : 'accessing - editor' }
+{ #category : #'accessing - editor' }
 AlbInfiniteEditorElement >> isEditable [
 
 	^ self mode isEditable
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> layoutPositionsRange: anInterval [
 	super layoutPositionsRange: anInterval.
 	"copy this interval to the text editor (data source) to be used by AlbTextEditorCommand"
 	self editor layoutPositionsRange: anInterval
 ]
 
-{ #category : 'accessing - mode' }
+{ #category : #'accessing - mode' }
 AlbInfiniteEditorElement >> mode [
 
 	<return: #BlText>
@@ -328,14 +326,14 @@ AlbInfiniteEditorElement >> mode [
 	^ mode
 ]
 
-{ #category : 'accessing - mode' }
+{ #category : #'accessing - mode' }
 AlbInfiniteEditorElement >> mode: anEditabilityMode [
 
 	mode = anEditabilityMode ifTrue: [ ^ self ].
 	mode := anEditabilityMode
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> modeChanged [
 
 	wordStencil := self defaultWordStencil.
@@ -344,58 +342,58 @@ AlbInfiniteEditorElement >> modeChanged [
 	self setupModeShortcuts
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> modeEventHandlersDo: aBlock [
 
 	modeEventHandlers ifNotNil: [ modeEventHandlers do: aBlock ]
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> modeShortcutsDo: aBlock [
 
 	modeShortcuts ifNotNil: [ modeShortcuts do: aBlock ]
 ]
 
-{ #category : 'event management' }
+{ #category : #'event management' }
 AlbInfiniteEditorElement >> mouseDownEvent: anEvent [
 	self selectionChanged
 ]
 
-{ #category : 'editor - operator' }
+{ #category : #'editor - operator' }
 AlbInfiniteEditorElement >> navigator [
 	<return: #AlbTextEditorNavigator>
 
 	^ self editor navigator
 ]
 
-{ #category : 'hooks - geometry' }
+{ #category : #'hooks - geometry' }
 AlbInfiniteEditorElement >> onExtentChanged [
 	super onExtentChanged.
 	self geometryChanged	
 ]
 
-{ #category : 'focus accessing' }
+{ #category : #'focus accessing' }
 AlbInfiniteEditorElement >> onGotFocus [
 
 	self editor onGotFocus.
 	self cursorElement ifNotNil: [ :c | c onGotFocus ]
 ]
 
-{ #category : 'focus accessing' }
+{ #category : #'focus accessing' }
 AlbInfiniteEditorElement >> onLostFocus [
 
 	self editor onLostFocus.
 	self cursorElement ifNotNil: [:ce | ce onLostFocus]
 ]
 
-{ #category : 'hooks - scrolling' }
+{ #category : #'hooks - scrolling' }
 AlbInfiniteEditorElement >> onScrolled: aPoint [
 	super onScrolled: aPoint.
 	self geometryChanged
 
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> piecesAndTheirElementsDo: aBlock [
 
 	self childrenDo: [ :segmentElement | 
@@ -414,7 +412,7 @@ AlbInfiniteEditorElement >> piecesAndTheirElementsDo: aBlock [
 				 ifAbsent: [  ]) ifNotNil: [ :foundPiece | aBlock value: foundPiece value: element]]]"
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> piecesAndTheirElementsWithinIndexInterval: anInterval do: aBlock [
 
 	self piecesAndTheirElementsDo: [ :piece :pieceElement | 
@@ -422,12 +420,12 @@ AlbInfiniteEditorElement >> piecesAndTheirElementsWithinIndexInterval: anInterva
 			aBlock value: piece value: pieceElement ] ]
 ]
 
-{ #category : 'accessing - editor' }
+{ #category : #'accessing - editor' }
 AlbInfiniteEditorElement >> removeEditorShortcut: aTextEditorInteraction [
 	self editor removeEditorShortcut: aTextEditorInteraction
 ]
 
-{ #category : 't  - layout resizeable' }
+{ #category : #'t  - layout resizeable' }
 AlbInfiniteEditorElement >> resizableConstraintsDo: aBlock [
 	"Perform aBlock with my constraints as argument.
 	Note: After evaluation I request a layout update!
@@ -443,45 +441,45 @@ AlbInfiniteEditorElement >> resizableConstraintsDo: aBlock [
 	self constraintsDo: aBlock
 ]
 
-{ #category : 'scrolling' }
+{ #category : #scrolling }
 AlbInfiniteEditorElement >> scrollToLast [
 	"Scroll instantly to the last segment"
 	
 	self scrollToPosition: self editor segmentCollector computedSegmentsCount
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> segments [
 	^ self editor segmentCollector segments
 ]
 
-{ #category : 'accessing - selection' }
+{ #category : #'accessing - selection' }
 AlbInfiniteEditorElement >> selectedText [
 
 	^ self editor selectedText
 ]
 
-{ #category : 'editor - operator' }
+{ #category : #'editor - operator' }
 AlbInfiniteEditorElement >> selecter [
 	<return: #AlbTextEditorSelecter>
 
 	^ self editor selecter
 ]
 
-{ #category : 'accessing - selection' }
+{ #category : #'accessing - selection' }
 AlbInfiniteEditorElement >> selection [
 	<return: #BlSelection>
 
 	^ self editor selection
 ]
 
-{ #category : 'event management' }
+{ #category : #'event management' }
 AlbInfiniteEditorElement >> selectionChanged [
 
 	"self selectionViewDo: [ :selView | selView selectionChangedIn: self ]"
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> setupModeEventHandlers [
 
 	self modeEventHandlersDo: [ :e | self removeEventHandler: e ].
@@ -493,7 +491,7 @@ AlbInfiniteEditorElement >> setupModeEventHandlers [
 
 ]
 
-{ #category : 'private - accessing editor' }
+{ #category : #'private - accessing editor' }
 AlbInfiniteEditorElement >> setupModeShortcuts [
 
 	self modeShortcutsDo: [ :eachShortcut | self editor removeEditorShortcut: eachShortcut ].
@@ -502,7 +500,7 @@ AlbInfiniteEditorElement >> setupModeShortcuts [
 	
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> subTextOnScreen [
 	
 	| interval |
@@ -511,7 +509,7 @@ AlbInfiniteEditorElement >> subTextOnScreen [
 
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> subTextOnScreenInterval [
 	
 	| holder first last |
@@ -525,7 +523,7 @@ AlbInfiniteEditorElement >> subTextOnScreenInterval [
 
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> text [
 	"Return a text I work with. All modifications to a text must be done from UI thread"
 	<return: #BlText>
@@ -533,19 +531,19 @@ AlbInfiniteEditorElement >> text [
 	^ self editor privateText
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> text: aText [
 
 	aText == self editor privateText ifTrue: [ ^ self ].
 	self editor privateText: aText asRopedText
 ]
 
-{ #category : 'api - editor' }
+{ #category : #'api - editor' }
 AlbInfiniteEditorElement >> textEdited [
 
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> textElementsDo: aBlock [
 
 	self childrenDo: [ :segmentElement | 
@@ -560,7 +558,7 @@ AlbInfiniteEditorElement >> textElementsDo: aBlock [
 				ifAbsent: [  ] ] ]
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> textElementsSelect: aSelectBlock [
 
 	^ Array streamContents: [ :stream | 
@@ -576,7 +574,7 @@ AlbInfiniteEditorElement >> textElementsSelect: aSelectBlock [
 				ifAbsent: [  ] ] ] ]
 ]
 
-{ #category : 'private - accessing text' }
+{ #category : #'private - accessing text' }
 AlbInfiniteEditorElement >> textInternalRepresentationChanged [
 
 	self editor processCursorAttributes.
@@ -585,20 +583,20 @@ AlbInfiniteEditorElement >> textInternalRepresentationChanged [
 					 update
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 AlbInfiniteEditorElement >> textLeft [
 
 	^ self margin left + self padding left 
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> textPiecesAndTheirElementsDo: aBlock [
 
 	self piecesAndTheirElementsDo: [ :piece :pieceElement | 
 		piece isText ifTrue: [ aBlock value: piece value: pieceElement ] ]
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> textPiecesAndTheirElementsWithinIndexInterval: anInterval do: aBlock [
 
 	self textPiecesAndTheirElementsDo: [ :piece :pieceElement | 
@@ -606,7 +604,7 @@ AlbInfiniteEditorElement >> textPiecesAndTheirElementsWithinIndexInterval: anInt
 			aBlock value: piece value: pieceElement ] ]
 ]
 
-{ #category : 'accessing - text' }
+{ #category : #'accessing - text' }
 AlbInfiniteEditorElement >> textSnapshot [
 	"Return a snaphost (copy) of the current text.
 	I am safe to use from a non-UI thread because the returned text is independent from the
@@ -616,7 +614,7 @@ AlbInfiniteEditorElement >> textSnapshot [
 	^ self editor textSnapshot
 ]
 
-{ #category : 'accessing - editor' }
+{ #category : #'accessing - editor' }
 AlbInfiniteEditorElement >> whenEditorChangedDo: aBlock [
 
 	self addEventHandler: (BlEventHandler
@@ -624,7 +622,7 @@ AlbInfiniteEditorElement >> whenEditorChangedDo: aBlock [
 			 do: aBlock)
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> whenModeChangedDo: aBlock [
 
 	"set a block to perform after that the mode has been chanbed, and its action performed"
@@ -632,14 +630,14 @@ AlbInfiniteEditorElement >> whenModeChangedDo: aBlock [
 	self property: #mode whenChangedDo: aBlock
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> whenTextEditedDo: aBlock [
 
 	self deprecated: 'Use directly editorDo: [:ed | ed when: AlbTextEditedEvent do: ] instead'. 
 	self editor whenTextEditedDo: aBlock
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> whenTextReplacedDo: aBlock [
 
 	self editor addEventHandler: (BlEventHandler
@@ -647,44 +645,44 @@ AlbInfiniteEditorElement >> whenTextReplacedDo: aBlock [
 			 do: aBlock)
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> withRowNumbers [
 
 	self withDecoration: AlbRowNumberDecoration
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> withSoftLine [
 
 	self hMatchParent
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbInfiniteEditorElement >> withoutCacheLimit [
 
 	self editor withoutCacheLimit
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> withoutRowNumbers [
 
 	self withoutDecoration: AlbRowNumberDecoration
 ]
 
-{ #category : 'view - configuration' }
+{ #category : #'view - configuration' }
 AlbInfiniteEditorElement >> withoutSoftLine [
 
 	self constraintsDo: [ :c | c horizontal fitContent ]
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> wordStencil [
 
 	<return: #AlbTextWordPieceStencil>
 	^ wordStencil
 ]
 
-{ #category : 'private - view accessing' }
+{ #category : #'private - view accessing' }
 AlbInfiniteEditorElement >> wordStencil: aWordStencil [
 
 	wordStencil := aWordStencil
diff --git a/src/Album/AlbInfiniteTextFieldElement.class.st b/src/Album/AlbInfiniteTextFieldElement.class.st
index a01e14f..26a74e2 100644
--- a/src/Album/AlbInfiniteTextFieldElement.class.st
+++ b/src/Album/AlbInfiniteTextFieldElement.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbInfiniteTextFieldElement',
-	#superclass : 'AlbInfiniteEditorElement',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbInfiniteTextFieldElement,
+	#superclass : #AlbInfiniteEditorElement,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbInfiniteTextFieldElement >> defaulTextEditor [
 
 	^ AlbTextFieldEditor new.
diff --git a/src/Album/AlbLineFlowLayout.class.st b/src/Album/AlbLineFlowLayout.class.st
index 3f326ef..bb21b12 100644
--- a/src/Album/AlbLineFlowLayout.class.st
+++ b/src/Album/AlbLineFlowLayout.class.st
@@ -4,23 +4,21 @@ I am a special kind of Flow layout optimized to layout small text piece elements
 I do not support children matching parent. All of them must have either exact of fit content resizing strategies.
 "
 Class {
-	#name : 'AlbLineFlowLayout',
-	#superclass : 'BlLayout',
+	#name : #AlbLineFlowLayout,
+	#superclass : #BlLayout,
 	#instVars : [
 		'lines',
 		'lineSpacing'
 	],
-	#category : 'Album-Layout',
-	#package : 'Album',
-	#tag : 'Layout'
+	#category : 'Album-Layout'
 }
 
-{ #category : 'constraints' }
+{ #category : #constraints }
 AlbLineFlowLayout class >> constraints [
 	^ AlbLineFlowLayoutConstraints new
 ]
 
-{ #category : 'measure' }
+{ #category : #measure }
 AlbLineFlowLayout >> adaptLinesLastElementMeasureToFillLine: anElement [
 
 	"In case a the selection should fill line, each last (soft) line element should be resized to fill the available horizontal space"
@@ -32,7 +30,7 @@ AlbLineFlowLayout >> adaptLinesLastElementMeasureToFillLine: anElement [
 						 + ((anElement measuredWidth - aLine width max: 0.0) @ theLastElement padding height negated)) ] ] ]
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbLineFlowLayout >> findClosestChildOf: anElement to: aPoint [
 	<return: #BlElement>
 	| aClosestLine |
@@ -41,7 +39,7 @@ AlbLineFlowLayout >> findClosestChildOf: anElement to: aPoint [
 	^ aClosestLine findClosestChildOf: anElement to: aPoint
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbLineFlowLayout >> findClosestLineTo: aPoint [
 	<return: #AlbFlowLine>
 	| aClosestLine aClosestDistance |
@@ -61,24 +59,24 @@ AlbLineFlowLayout >> findClosestLineTo: aPoint [
 	^ aClosestLine
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayout >> hasElements [
 	^ lines notNil and: [ lines elements notNil ]
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayout >> hasLines [
 	^ lines notNil
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayout >> initialize [
 	super initialize.
 	
 	lineSpacing := 0
 ]
 
-{ #category : 'layout' }
+{ #category : #layout }
 AlbLineFlowLayout >> layout: anElement in: aRectangle context: aBlElementBoundsUpdateContext [
 	| anOffsetX anOffsetY aLeft aTop |
 
@@ -111,17 +109,17 @@ AlbLineFlowLayout >> layout: anElement in: aRectangle context: aBlElementBoundsU
 	self layoutIgnored: anElement context: aBlElementBoundsUpdateContext
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayout >> lineSpacing [
 	^ lineSpacing
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayout >> lineSpacing: anObject [
 	lineSpacing := anObject
 ]
 
-{ #category : 'measure' }
+{ #category : #measure }
 AlbLineFlowLayout >> measure: anElement with: anExtentSpec [
 
 	| maxWidth maxHeight aCurrentLine totalContentWidth totalContentHeight measuredWidth textFlow |
@@ -164,12 +162,12 @@ AlbLineFlowLayout >> measure: anElement with: anExtentSpec [
 	self measureIgnored: anElement with: anExtentSpec
 ]
 
-{ #category : 'hooks - layout' }
+{ #category : #'hooks - layout' }
 AlbLineFlowLayout >> onCleanUp: anElement [
 	self resetLines
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayout >> resetLines [
 	lines ifNotNil: [ :theLines | theLines reset ]
 ]
diff --git a/src/Album/AlbLineFlowLayoutConstraints.class.st b/src/Album/AlbLineFlowLayoutConstraints.class.st
index 218f801..4ae5aaa 100644
--- a/src/Album/AlbLineFlowLayoutConstraints.class.st
+++ b/src/Album/AlbLineFlowLayoutConstraints.class.st
@@ -2,8 +2,8 @@
 I am special text flow layout constraints that add support line breaking and pushing which is very useful for embedding visual elements in moldable text editor.
 "
 Class {
-	#name : 'AlbLineFlowLayoutConstraints',
-	#superclass : 'BlLayoutConstraints',
+	#name : #AlbLineFlowLayoutConstraints,
+	#superclass : #BlLayoutConstraints,
 	#instVars : [
 		'pushLine',
 		'breakLineBefore',
@@ -15,50 +15,48 @@ Class {
 	#classVars : [
 		'ShouldFillLine'
 	],
-	#category : 'Album-Layout',
-	#package : 'Album',
-	#tag : 'Layout'
+	#category : 'Album-Layout'
 }
 
-{ #category : 'asserting' }
+{ #category : #asserting }
 AlbLineFlowLayoutConstraints class >> shouldFillLine [
 	"Return true if the element should fill all available space in the line if it is the last element"
 
 	^ ShouldFillLine ifNil: [ ShouldFillLine := false ]
 ]
 
-{ #category : 'asserting' }
+{ #category : #asserting }
 AlbLineFlowLayoutConstraints class >> shouldFillLine: aBoolean [
 	"true if the element should fill all available space in the line if it is the last element"
 
 	ShouldFillLine := aBoolean
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> assignToLine: aEditorTextFlowLine [
 	assignedLine := aEditorTextFlowLine
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> assignedLine [
 	^ assignedLine
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayoutConstraints >> breakLineAfter [
 	"Mark an element such that a line should be broken AFTER it"
 
 	breakLineAfter := true
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayoutConstraints >> breakLineBefore [
 	"Mark an element such that a line should be broken BEFORE it"
 
 	breakLineBefore := true
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayoutConstraints >> initialize [
 	super initialize.
 	breakLineBefore := false.
@@ -67,36 +65,36 @@ AlbLineFlowLayoutConstraints >> initialize [
 	offsetFromSegmentStart := 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> offsetFromSegmentStart [
 	"computed and set during layout"
 	^ offsetFromSegmentStart
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> offsetFromSegmentStart: aNumber [
 	"computed and set during layout"
 	offsetFromSegmentStart := aNumber
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> positionInEditor [
 	^ positionInEditor 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbLineFlowLayoutConstraints >> positionInEditor: aPoint [
 	positionInEditor := aPoint
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbLineFlowLayoutConstraints >> pushLine [
 	"Mark an element such that it will be pushed to the new line after the current line"
 	
 	pushLine := true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayoutConstraints >> shouldBreakLineAfter [
 	"Return true if current line should be broken AFTER an element, false otherwise"
 	<return: #Boolean>
@@ -104,7 +102,7 @@ AlbLineFlowLayoutConstraints >> shouldBreakLineAfter [
 	^ breakLineAfter
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayoutConstraints >> shouldBreakLineBefore [
 	"Return true if current line should be broken BEFORE an element, false otherwise"
 	<return: #Boolean>
@@ -112,14 +110,14 @@ AlbLineFlowLayoutConstraints >> shouldBreakLineBefore [
 	^ breakLineBefore
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayoutConstraints >> shouldFillLine [
 	"Return true if the element should fill all available space in the line if it is the last element"
 
 	^ self class shouldFillLine
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbLineFlowLayoutConstraints >> shouldPushLine [
 	"Return true if an element should be pushed to the new line after the end of the current line, false otherwise"
 	<return: #Boolean>
diff --git a/src/Album/AlbOppositeDelimiterElement.class.st b/src/Album/AlbOppositeDelimiterElement.class.st
index ec23225..2cabc6c 100644
--- a/src/Album/AlbOppositeDelimiterElement.class.st
+++ b/src/Album/AlbOppositeDelimiterElement.class.st
@@ -1,21 +1,19 @@
 Class {
-	#name : 'AlbOppositeDelimiterElement',
-	#superclass : 'AlbTextPortionElement',
+	#name : #AlbOppositeDelimiterElement,
+	#superclass : #AlbTextPortionElement,
 	#instVars : [
 		'anim'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbOppositeDelimiterElement >> borderColor [
 
 	^ Color gray
 ]
 
-{ #category : 'cleanup' }
+{ #category : #cleanup }
 AlbOppositeDelimiterElement >> cleanUp [
 
 	anim ifNotNil: [
@@ -23,13 +21,13 @@ AlbOppositeDelimiterElement >> cleanUp [
 		anim := nil ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbOppositeDelimiterElement >> defaultBackground [ 
 
 	^ Color yellow 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbOppositeDelimiterElement >> initialize [
 
 	super initialize.
@@ -38,7 +36,7 @@ AlbOppositeDelimiterElement >> initialize [
 	self addAnimation: anim
 ]
 
-{ #category : 'removing' }
+{ #category : #removing }
 AlbOppositeDelimiterElement >> removeFromParent [ 
 
 	self cleanUp.
diff --git a/src/Album/AlbPrimarySelectionElement.class.st b/src/Album/AlbPrimarySelectionElement.class.st
index 0520543..0e95dc9 100644
--- a/src/Album/AlbPrimarySelectionElement.class.st
+++ b/src/Album/AlbPrimarySelectionElement.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbPrimarySelectionElement',
-	#superclass : 'AlbAbstractSubtextElement',
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#name : #AlbPrimarySelectionElement,
+	#superclass : #AlbAbstractSubtextElement,
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbPrimarySelectionElement >> defaultUpdateStrategy [
 
 	^ AlbPrimarySelectionElementUpdateStrategy new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbPrimarySelectionElement >> initialize [
 
 	super initialize.
@@ -28,33 +26,33 @@ AlbPrimarySelectionElement >> initialize [
 	self outskirts: BlOutskirts centered
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbPrimarySelectionElement >> onGotFocus [
 
 	self background: editorElement selectionColor.
 	self border:	(BlBorder paint: editorElement selectionColor twiceDarker  width: self borderWidth)
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbPrimarySelectionElement >> onInstalled [
 
 	self editorElement infinite whenModeChangedDo: [ self onUninstalled ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbPrimarySelectionElement >> onLostFocus [
 
 	self background: (editorElement selectionColor alpha: 0.1)
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbPrimarySelectionElement >> onUninstalled [
 
 	updateStrategy onUninstalledIn: self
 
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbPrimarySelectionElement >> selectionRectangles [
 
 	"return all selections rectangles from coordinate system of text elements with selection to my local coordinates"
@@ -65,7 +63,7 @@ AlbPrimarySelectionElement >> selectionRectangles [
 					stream nextPut: ((editorElement localBoundsToMine: (BlBounds fromRectangle: r) fromChild: te) translateBy: 0 @ (te position y) negated ) ] ] ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbPrimarySelectionElement >> updateVertices [
 
 	editorElement ifNil: [ ^ self ].
diff --git a/src/Album/AlbPrimarySelectionElementUpdateStrategy.class.st b/src/Album/AlbPrimarySelectionElementUpdateStrategy.class.st
index 14fff4b..39bcf37 100644
--- a/src/Album/AlbPrimarySelectionElementUpdateStrategy.class.st
+++ b/src/Album/AlbPrimarySelectionElementUpdateStrategy.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbPrimarySelectionElementUpdateStrategy',
-	#superclass : 'AlbSubtextElementUpdateOnExtentChangeStrategy',
+	#name : #AlbPrimarySelectionElementUpdateStrategy,
+	#superclass : #AlbSubtextElementUpdateOnExtentChangeStrategy,
 	#instVars : [
 		'focusHandler',
 		'blurHandler',
 		'selectionHandler',
 		'editorChangeHandler'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbPrimarySelectionElementUpdateStrategy >> onInstalledIn: aSubTextElement [
 
 	super onInstalledIn: aSubTextElement.
@@ -34,7 +32,7 @@ AlbPrimarySelectionElementUpdateStrategy >> onInstalledIn: aSubTextElement [
 	aSubTextElement editorElement infinite addEventHandler: blurHandler
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbPrimarySelectionElementUpdateStrategy >> onUninstalledIn: aSubTextElement [
 	
 	aSubTextElement editorElement editor removeEventHandler: selectionHandler.
diff --git a/src/Album/AlbReadonlyWithSelectionMode.class.st b/src/Album/AlbReadonlyWithSelectionMode.class.st
index 31aa70b..739886a 100644
--- a/src/Album/AlbReadonlyWithSelectionMode.class.st
+++ b/src/Album/AlbReadonlyWithSelectionMode.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbReadonlyWithSelectionMode',
-	#superclass : 'AlbEditabilityMode',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbReadonlyWithSelectionMode,
+	#superclass : #AlbEditabilityMode,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithSelectionMode >> defaultEditorElementEventHandlers [
 
 	^ { 
@@ -15,14 +13,14 @@ AlbReadonlyWithSelectionMode >> defaultEditorElementEventHandlers [
 		  AlbTextEditorFocusHandler new }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithSelectionMode >> defaultFrontLayerEventHandlers [
 
 	^ {  AlbTextEditorCursorIconHandler new .
 		  AlbTextEditorSelectionHandler new }
 ]
 
-{ #category : 'shortcut management' }
+{ #category : #'shortcut management' }
 AlbReadonlyWithSelectionMode >> defaultShortcuts [
 
 	^ { 
diff --git a/src/Album/AlbReadonlyWithoutSelectionMode.class.st b/src/Album/AlbReadonlyWithoutSelectionMode.class.st
index 851ed66..1b94bb0 100644
--- a/src/Album/AlbReadonlyWithoutSelectionMode.class.st
+++ b/src/Album/AlbReadonlyWithoutSelectionMode.class.st
@@ -1,37 +1,35 @@
 Class {
-	#name : 'AlbReadonlyWithoutSelectionMode',
-	#superclass : 'AlbEditabilityMode',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbReadonlyWithoutSelectionMode,
+	#superclass : #AlbEditabilityMode,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithoutSelectionMode >> defaultEditorElementEventHandlers [
 
 	^ {  }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithoutSelectionMode >> defaultFrontLayerEventHandlers [
 
 	^ {  }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithoutSelectionMode >> defaultSelectionView [
 
 	^ nil
 
 ]
 
-{ #category : 'shortcut management' }
+{ #category : #'shortcut management' }
 AlbReadonlyWithoutSelectionMode >> defaultShortcuts [
 
 	^ {  }
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbReadonlyWithoutSelectionMode >> primarySelectionElementIn: anEditorElement [
 
 	^ nil
diff --git a/src/Album/AlbRemanentsUpdater.class.st b/src/Album/AlbRemanentsUpdater.class.st
index 7e107b2..724c86c 100644
--- a/src/Album/AlbRemanentsUpdater.class.st
+++ b/src/Album/AlbRemanentsUpdater.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbRemanentsUpdater',
-	#superclass : 'AlbTextPortionUpdater',
+	#name : #AlbRemanentsUpdater,
+	#superclass : #AlbTextPortionUpdater,
 	#instVars : [
 		'oppositeEcho',
 		'textReplacedHandler'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'opposite delimiter' }
+{ #category : #'opposite delimiter' }
 AlbRemanentsUpdater >> closeOppositeDelimiter: oppositeTextElement at: localIdx in: anEditorElement [
 
 	| bnds origin corner width |
@@ -27,7 +25,7 @@ AlbRemanentsUpdater >> closeOppositeDelimiter: oppositeTextElement at: localIdx
 		  size: bnds extent
 ]
 
-{ #category : 'opposite delimiter' }
+{ #category : #'opposite delimiter' }
 AlbRemanentsUpdater >> createOppositeDelimiterIn: anEditorElement [
 
 	| cursorPos text |
@@ -62,7 +60,7 @@ AlbRemanentsUpdater >> createOppositeDelimiterIn: anEditorElement [
 	^ nil
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbRemanentsUpdater >> cursorMovedIn: anEditorElement [ 
 
 	super cursorMovedIn: anEditorElement.
@@ -70,7 +68,7 @@ AlbRemanentsUpdater >> cursorMovedIn: anEditorElement [
 
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbRemanentsUpdater >> extentChangedIn: anEditorElement [ 
 
 	self resetPortionsIn: anEditorElement..
@@ -79,7 +77,7 @@ AlbRemanentsUpdater >> extentChangedIn: anEditorElement [
 
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbRemanentsUpdater >> onInstalledIn: anEditorElement [
 
 	super onInstalledIn: anEditorElement.
@@ -90,7 +88,7 @@ AlbRemanentsUpdater >> onInstalledIn: anEditorElement [
 	anEditorElement infinite addEventHandler: textReplacedHandler
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbRemanentsUpdater >> onUninstalledIn: anEditorElement [
 
 	anEditorElement infinite removeEventHandler: textReplacedHandler.
@@ -98,7 +96,7 @@ AlbRemanentsUpdater >> onUninstalledIn: anEditorElement [
 
 ]
 
-{ #category : 'opposite delimiter' }
+{ #category : #'opposite delimiter' }
 AlbRemanentsUpdater >> openOppositeDelimiter: oppositeTextElement at: localIdx in: anEditorElement [
 
 	| bnds origin corner width |
@@ -115,7 +113,7 @@ AlbRemanentsUpdater >> openOppositeDelimiter: oppositeTextElement at: localIdx i
 		  size: bnds extent
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbRemanentsUpdater >> scrollEventIn: anEditorElement [ 
 
 	self resetPortionsIn: anEditorElement.
@@ -124,7 +122,7 @@ AlbRemanentsUpdater >> scrollEventIn: anEditorElement [
 
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbRemanentsUpdater >> selectionChangedIn: anEditorElement [
 
 	super selectionChangedIn: anEditorElement.
@@ -132,7 +130,7 @@ AlbRemanentsUpdater >> selectionChangedIn: anEditorElement [
 	self updateOppositeDelimiterIn: anEditorElement
 ]
 
-{ #category : 'opposite delimiter' }
+{ #category : #'opposite delimiter' }
 AlbRemanentsUpdater >> updateOppositeDelimiterIn: anEditorElement [
 
 	oppositeEcho ifNotNil: [
@@ -143,7 +141,7 @@ AlbRemanentsUpdater >> updateOppositeDelimiterIn: anEditorElement [
 	oppositeEcho ifNotNil: [	anEditorElement addChild: oppositeEcho]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbRemanentsUpdater >> updatePortionsIn: anEditorElement [
 
 	self terminateUpdater.
diff --git a/src/Album/AlbRowNumberDecoration.class.st b/src/Album/AlbRowNumberDecoration.class.st
index 05137e0..42438d9 100644
--- a/src/Album/AlbRowNumberDecoration.class.st
+++ b/src/Album/AlbRowNumberDecoration.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbRowNumberDecoration',
-	#superclass : 'BlRowNumberDecoration',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbRowNumberDecoration,
+	#superclass : #BlRowNumberDecoration,
+	#category : 'Album-UI'
 }
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbRowNumberDecoration >> numberVerticalHeightIn: anItemElement fontHeight: fontHeight [
 
 	" redefined to have the number on top of a soft line "
 	^ 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbRowNumberDecoration >> selectionBackgroundOf: anItemElement in: anInfiniteElement [
 
 	^ Color gray alpha: 0.2
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbRowNumberDecoration >> selectionLimitRectangleOf: anItemElement in: anInfiniteElement [
 
 	" Select lines with cursor or with an element at left which has a selection that start at 0 "
@@ -32,7 +30,7 @@ AlbRowNumberDecoration >> selectionLimitRectangleOf: anItemElement in: anInfinit
 		^ 0 @ l first origin y corner: self computedBounds width - self gap @ (l last origin y + l last height) ]
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbRowNumberDecoration >> selectionLimitRectangleOf: anItemElement in: anInfiniteElement do: aBlock [
 	(self selectionLimitRectangleOf: anItemElement in: anInfiniteElement) ifNotNil: [ :bnds | aBlock value: bnds ]
 ]
diff --git a/src/Album/AlbSelectionChangedEvent.class.st b/src/Album/AlbSelectionChangedEvent.class.st
index dba407d..e4c2f53 100644
--- a/src/Album/AlbSelectionChangedEvent.class.st
+++ b/src/Album/AlbSelectionChangedEvent.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbSelectionChangedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbSelectionChangedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'selection'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSelectionChangedEvent >> selection [
 	^ selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSelectionChangedEvent >> selection: anObject [
 	selection := anObject
 ]
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbSelectionChangedEvent >> sendTo: anHandler [
 
 	anHandler selectionChangedEvent: self
diff --git a/src/Album/AlbShortcutAddedEvent.class.st b/src/Album/AlbShortcutAddedEvent.class.st
index 041936e..3429051 100644
--- a/src/Album/AlbShortcutAddedEvent.class.st
+++ b/src/Album/AlbShortcutAddedEvent.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbShortcutAddedEvent',
-	#superclass : 'AlbShortcutChangedEvent',
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#name : #AlbShortcutAddedEvent,
+	#superclass : #AlbShortcutChangedEvent,
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbShortcutAddedEvent >> sendTo: anEventHandler [
 
 	anEventHandler shortcutAddedEvent: self
diff --git a/src/Album/AlbShortcutChangedEvent.class.st b/src/Album/AlbShortcutChangedEvent.class.st
index bb83be1..69cfb08 100644
--- a/src/Album/AlbShortcutChangedEvent.class.st
+++ b/src/Album/AlbShortcutChangedEvent.class.st
@@ -1,20 +1,18 @@
 Class {
-	#name : 'AlbShortcutChangedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbShortcutChangedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'shortcut'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbShortcutChangedEvent >> shortcut [
 	^ shortcut
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbShortcutChangedEvent >> shortcut: aShortcut [
 	shortcut := aShortcut
 ]
diff --git a/src/Album/AlbShortcutRemovedEvent.class.st b/src/Album/AlbShortcutRemovedEvent.class.st
index 5001ae9..2ad1e4a 100644
--- a/src/Album/AlbShortcutRemovedEvent.class.st
+++ b/src/Album/AlbShortcutRemovedEvent.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbShortcutRemovedEvent',
-	#superclass : 'AlbShortcutChangedEvent',
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#name : #AlbShortcutRemovedEvent,
+	#superclass : #AlbShortcutChangedEvent,
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbShortcutRemovedEvent >> sendTo: anEventHandler [
 
 	anEventHandler shortcutRemovedEvent: self
diff --git a/src/Album/AlbSubtextElement.class.st b/src/Album/AlbSubtextElement.class.st
index 402e54d..136d77a 100644
--- a/src/Album/AlbSubtextElement.class.st
+++ b/src/Album/AlbSubtextElement.class.st
@@ -1,18 +1,17 @@
 Class {
-	#name : 'AlbSubtextElement',
-	#superclass : 'AlbAbstractSubtextElement',
+	#name : #AlbSubtextElement,
+	#superclass : #AlbAbstractSubtextElement,
 	#instVars : [
 		'interval'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : #'Album-UI-Text-Portion'
 }
 
-{ #category : 'private' }
+{ #category : #private }
 AlbSubtextElement >> computedAdjacentRectangles [
 
 	| startIdx endIdx |
+	self interval ifNil: [ ^ #() ].
 	startIdx := self interval first.
 	endIdx := self interval last.
 	^ Array streamContents: [ :stream | 
@@ -39,27 +38,27 @@ AlbSubtextElement >> computedAdjacentRectangles [
 				         				stream nextPut: bnds ] ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbSubtextElement >> initialize [
 
 	super initialize.
 	interval := 0 to: 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextElement >> interval [
 
 	^ interval
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextElement >> interval: anInterval [
 
 	interval := anInterval.
 	self updateVertices 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbSubtextElement >> updateVertices [
 
 	editorElement ifNil: [ ^ self ].
diff --git a/src/Album/AlbSubtextElementNoUpdateStrategy.class.st b/src/Album/AlbSubtextElementNoUpdateStrategy.class.st
index 679b264..11b0733 100644
--- a/src/Album/AlbSubtextElementNoUpdateStrategy.class.st
+++ b/src/Album/AlbSubtextElementNoUpdateStrategy.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbSubtextElementNoUpdateStrategy',
-	#superclass : 'AlbSubtextElementUpdateStrategy',
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#name : #AlbSubtextElementNoUpdateStrategy,
+	#superclass : #AlbSubtextElementUpdateStrategy,
+	#category : 'Album-UI-Text-Portion'
 }
diff --git a/src/Album/AlbSubtextElementUpdateOnExtentChangeStrategy.class.st b/src/Album/AlbSubtextElementUpdateOnExtentChangeStrategy.class.st
index 4331888..7162ce7 100644
--- a/src/Album/AlbSubtextElementUpdateOnExtentChangeStrategy.class.st
+++ b/src/Album/AlbSubtextElementUpdateOnExtentChangeStrategy.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbSubtextElementUpdateOnExtentChangeStrategy',
-	#superclass : 'AlbSubtextElementUpdateStrategy',
+	#name : #AlbSubtextElementUpdateOnExtentChangeStrategy,
+	#superclass : #AlbSubtextElementUpdateStrategy,
 	#instVars : [
 		'extentHandler',
 		'scrollHandler'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbSubtextElementUpdateOnExtentChangeStrategy >> onInstalledIn: aSubTextElement [
 
 	super onInstalledIn: aSubTextElement.
@@ -22,7 +20,7 @@ AlbSubtextElementUpdateOnExtentChangeStrategy >> onInstalledIn: aSubTextElement
 
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbSubtextElementUpdateOnExtentChangeStrategy >> onUninstalledIn: aSubTextElement [
 
 	aSubTextElement editorElement infinite removeEventHandler: extentHandler.
diff --git a/src/Album/AlbSubtextElementUpdateStrategy.class.st b/src/Album/AlbSubtextElementUpdateStrategy.class.st
index 68672bb..b9efd89 100644
--- a/src/Album/AlbSubtextElementUpdateStrategy.class.st
+++ b/src/Album/AlbSubtextElementUpdateStrategy.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbSubtextElementUpdateStrategy',
-	#superclass : 'Object',
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#name : #AlbSubtextElementUpdateStrategy,
+	#superclass : #Object,
+	#category : #'Album-UI-Text-Portion'
 }
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbSubtextElementUpdateStrategy >> onInstalledIn: aSubTextElement [
 
-	aSubTextElement whenLayoutedDoOnce: [ aSubTextElement updateVertices ]
+	aSubTextElement updateVertices
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbSubtextElementUpdateStrategy >> onUninstalledIn: aSubTextElement [
 ]
diff --git a/src/Album/AlbSubtextPortionBuilder.class.st b/src/Album/AlbSubtextPortionBuilder.class.st
index 42e9b74..786871f 100644
--- a/src/Album/AlbSubtextPortionBuilder.class.st
+++ b/src/Album/AlbSubtextPortionBuilder.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbSubtextPortionBuilder',
-	#superclass : 'Object',
+	#name : #AlbSubtextPortionBuilder,
+	#superclass : #Object,
 	#instVars : [
 		'subtext',
 		'fullText',
 		'parentElement',
 		'decorations'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'building' }
+{ #category : #building }
 AlbSubtextPortionBuilder >> createDecorations [
 
 	| collector founds |
@@ -23,7 +21,7 @@ AlbSubtextPortionBuilder >> createDecorations [
 	founds do: [ :interval | self decorationInterval: interval + fullText textOffset ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbSubtextPortionBuilder >> decorationInterval: anInterval [
 
 	anInterval = (parentElement selection from + 1 to: parentElement selection to) ifTrue: [ ^ self ].
@@ -32,33 +30,33 @@ AlbSubtextPortionBuilder >> decorationInterval: anInterval [
 			 yourself)
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextPortionBuilder >> decorations [
 
 	^ decorations
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextPortionBuilder >> fullText: aSubtext [
 
 	fullText := aSubtext
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbSubtextPortionBuilder >> initialize [ 
 
 	super initialize.
 	decorations := OrderedCollection new
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextPortionBuilder >> parentElement: anObject [
 
 	parentElement := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbSubtextPortionBuilder >> subtext: aSubtext [
 
 	subtext := aSubtext
diff --git a/src/Album/AlbTextAdornmentAttribute.class.st b/src/Album/AlbTextAdornmentAttribute.class.st
index bb6722f..717be5a 100644
--- a/src/Album/AlbTextAdornmentAttribute.class.st
+++ b/src/Album/AlbTextAdornmentAttribute.class.st
@@ -4,18 +4,16 @@ I am an attribute which when applied on a text visually replaces some parts of i
 See `AlbTextEditorAdornmentsExamples`
 "
 Class {
-	#name : 'AlbTextAdornmentAttribute',
-	#superclass : 'BlTextAttribute',
+	#name : #AlbTextAdornmentAttribute,
+	#superclass : #BlTextAttribute,
 	#instVars : [
 		'shouldAppend',
 		'renderingStrategy'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> affect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -23,27 +21,27 @@ AlbTextAdornmentAttribute >> affect: aTTextEditorTextualPiece in: anEditorElemen
 	^ self renderingStrategy affect: aTTextEditorTextualPiece in: anEditorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> beAppend [
 	shouldAppend := true
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> beLazy [
 	self renderingStrategy: AlbTextAdornmentAttributeTaskItRenderingStrategy new.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> beReplace [
 	shouldAppend := false
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> beSync [
 	self renderingStrategy: AlbTextAdornmentAttributeSyncRenderingStrategy new.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -51,7 +49,7 @@ AlbTextAdornmentAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElem
 	^ self subclassResponsibility
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextAdornmentAttribute >> initialize [
 	super initialize.
 	
@@ -59,12 +57,12 @@ AlbTextAdornmentAttribute >> initialize [
 	self renderingStrategy: AlbTextAdornmentAttributeSyncRenderingStrategy new.
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextAdornmentAttribute >> initializeLazyElement: aBlLazyElement [
 	"Subclasses can initialize the element"
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> isAdornment [
 	"Return true if attribute influences text structure, for examples if it replaces one or more characters
 	with any amount of other arbitrary items, false otherwise"
@@ -73,7 +71,7 @@ AlbTextAdornmentAttribute >> isAdornment [
 	^ true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> isFocusable [
 	"Return true if an element (but not its children) created by the adornment attribute can be focused"
 	<return: #Boolean>
@@ -81,27 +79,27 @@ AlbTextAdornmentAttribute >> isFocusable [
 	^ false
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> isStyle [
 	"I am not a text style related attribute"
 
 	^ false
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> mayHaveExternalReferences [
 	"Answer if this attribute can have references to some external objects like AST nodes or computation results"
 
 	^ true
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> renderingStrategy [
 	<return: #AlbTextAdornmentAttributeRenderingStrategy>
 	^ renderingStrategy
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttribute >> renderingStrategy: aTextAdornmentAttributeRenderingStrategy [
 	self 
 		assert: [ aTextAdornmentAttributeRenderingStrategy isNotNil ] 
@@ -110,17 +108,17 @@ AlbTextAdornmentAttribute >> renderingStrategy: aTextAdornmentAttributeRendering
 	renderingStrategy := aTextAdornmentAttributeRenderingStrategy
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> shouldAppend [
 	^ shouldAppend
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextAdornmentAttribute >> shouldReplace [
 	^ shouldAppend not
 ]
 
-{ #category : 'printing' }
+{ #category : #printing }
 AlbTextAdornmentAttribute >> storeOn: aStream [
 	super storeOn: aStream.
 	
@@ -130,7 +128,7 @@ AlbTextAdornmentAttribute >> storeOn: aStream [
 		ifFalse: [ #beReplace ]) asString
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextAdornmentAttribute >> type [
 	^ self
 ]
diff --git a/src/Album/AlbTextAdornmentAttributeRenderingStrategy.class.st b/src/Album/AlbTextAdornmentAttributeRenderingStrategy.class.st
index c3663cb..51f9ed0 100644
--- a/src/Album/AlbTextAdornmentAttributeRenderingStrategy.class.st
+++ b/src/Album/AlbTextAdornmentAttributeRenderingStrategy.class.st
@@ -1,30 +1,28 @@
 Class {
-	#name : 'AlbTextAdornmentAttributeRenderingStrategy',
-	#superclass : 'Object',
+	#name : #AlbTextAdornmentAttributeRenderingStrategy,
+	#superclass : #Object,
 	#traits : 'TBlDebug',
 	#classTraits : 'TBlDebug classTrait',
 	#instVars : [
 		'attribute'
 	],
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttributeRenderingStrategy >> affect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #BlElement>
 	^ self subclassResponsibility 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttributeRenderingStrategy >> attribute [
 	<return: #AlbTextAdornmentAttribute>
 	^ attribute
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttributeRenderingStrategy >> attribute: aTextAdornmentAttribute [
 	self 
 		assert: [ aTextAdornmentAttribute isNotNil ] 
diff --git a/src/Album/AlbTextAdornmentAttributeSyncRenderingStrategy.class.st b/src/Album/AlbTextAdornmentAttributeSyncRenderingStrategy.class.st
index 2c1a979..77a11d5 100644
--- a/src/Album/AlbTextAdornmentAttributeSyncRenderingStrategy.class.st
+++ b/src/Album/AlbTextAdornmentAttributeSyncRenderingStrategy.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextAdornmentAttributeSyncRenderingStrategy',
-	#superclass : 'AlbTextAdornmentAttributeRenderingStrategy',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextAdornmentAttributeSyncRenderingStrategy,
+	#superclass : #AlbTextAdornmentAttributeRenderingStrategy,
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttributeSyncRenderingStrategy >> affect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #BlElement>
diff --git a/src/Album/AlbTextAdornmentAttributeTaskItRenderingStrategy.class.st b/src/Album/AlbTextAdornmentAttributeTaskItRenderingStrategy.class.st
index 2100b9d..567b5a1 100644
--- a/src/Album/AlbTextAdornmentAttributeTaskItRenderingStrategy.class.st
+++ b/src/Album/AlbTextAdornmentAttributeTaskItRenderingStrategy.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextAdornmentAttributeTaskItRenderingStrategy',
-	#superclass : 'AlbTextAdornmentAttributeRenderingStrategy',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextAdornmentAttributeTaskItRenderingStrategy,
+	#superclass : #AlbTextAdornmentAttributeRenderingStrategy,
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentAttributeTaskItRenderingStrategy >> affect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #BlElement>
diff --git a/src/Album/AlbTextAdornmentDynamicAttribute.class.st b/src/Album/AlbTextAdornmentDynamicAttribute.class.st
index 69b9df4..099e011 100644
--- a/src/Album/AlbTextAdornmentDynamicAttribute.class.st
+++ b/src/Album/AlbTextAdornmentDynamicAttribute.class.st
@@ -20,17 +20,15 @@ For scripting purposes a block closure can be used instead. It can have two opti
 ]]]
 "
 Class {
-	#name : 'AlbTextAdornmentDynamicAttribute',
-	#superclass : 'AlbTextAdornmentAttribute',
+	#name : #AlbTextAdornmentDynamicAttribute,
+	#superclass : #AlbTextAdornmentAttribute,
 	#instVars : [
 		'stencilBuilder'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentDynamicAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -47,12 +45,12 @@ AlbTextAdornmentDynamicAttribute >> doAffect: aTTextEditorTextualPiece in: anEdi
 	^ aResult asElement asOrderedCollection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextAdornmentDynamicAttribute >> stencil: anAdornmentStencilBuilder [
 	stencilBuilder := anAdornmentStencilBuilder "asStencilBuilder: AlbTextAdornmentStencilBuilder"
 ]
 
-{ #category : 'printing' }
+{ #category : #printing }
 AlbTextAdornmentDynamicAttribute >> storeOn: aStream [
 	super storeOn: aStream.
 	
diff --git a/src/Album/AlbTextClickAttribute.class.st b/src/Album/AlbTextClickAttribute.class.st
index ed9d952..3b044cb 100644
--- a/src/Album/AlbTextClickAttribute.class.st
+++ b/src/Album/AlbTextClickAttribute.class.st
@@ -1,20 +1,18 @@
 Class {
-	#name : 'AlbTextClickAttribute',
-	#superclass : 'AlbTextCrappyEventHandlerAttribute',
+	#name : #AlbTextClickAttribute,
+	#superclass : #AlbTextCrappyEventHandlerAttribute,
 	#instVars : [
 		'action'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextClickAttribute >> action [
 	^ action
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextClickAttribute >> action: aValuable [
 	self 
 		assert: [ aValuable notNil ] 
@@ -23,19 +21,19 @@ AlbTextClickAttribute >> action: aValuable [
 	action := aValuable
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextClickAttribute >> handleEvent: anEvent [ 
 	self performAction: anEvent 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextClickAttribute >> initialize [
 	super initialize.
 	
 	action := [ :aTTextEditorTextualPiece :aTextElement :aTextEditor :anEvent | ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextClickAttribute >> performAction: anEvent [
 
 	"first we pass text then the text piece (word) element then the whole text editor and the event itself "
@@ -47,7 +45,7 @@ AlbTextClickAttribute >> performAction: anEvent [
 		value: anEvent wrappedEvent
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextClickAttribute >> wantsEvent: anEvent [ 
 	^ anEvent wrappedEvent isKindOf: BlClickEvent
 ]
diff --git a/src/Album/AlbTextCrappyEventHandlerAttribute.class.st b/src/Album/AlbTextCrappyEventHandlerAttribute.class.st
index 30f0656..36b6bfd 100644
--- a/src/Album/AlbTextCrappyEventHandlerAttribute.class.st
+++ b/src/Album/AlbTextCrappyEventHandlerAttribute.class.st
@@ -3,19 +3,17 @@
 Is the superclass of all attributes with the ability to handle some text events received by the visual text elements.
 "
 Class {
-	#name : 'AlbTextCrappyEventHandlerAttribute',
-	#superclass : 'BlTextAttribute',
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#name : #AlbTextCrappyEventHandlerAttribute,
+	#superclass : #BlTextAttribute,
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextCrappyEventHandlerAttribute >> handleEvent: anEvent [ 
 	self subclassResponsibility
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextCrappyEventHandlerAttribute >> isEventHandler [
 	"Return true if attribute is designed to handle UI events such as mouse,
 	false otherwise"
@@ -24,19 +22,19 @@ AlbTextCrappyEventHandlerAttribute >> isEventHandler [
 	^ true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextCrappyEventHandlerAttribute >> mayHaveExternalReferences [
 	"Answer if this attribute can have references to some external objects like AST nodes or computation results"
 
 	^ true
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextCrappyEventHandlerAttribute >> type [
 	^ self
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextCrappyEventHandlerAttribute >> wantsEvent: anEvent [ 
 	"Return true if I am interested in a given event and want to handle it,
 	false otherwise"
diff --git a/src/Album/AlbTextCursorAttribute.class.st b/src/Album/AlbTextCursorAttribute.class.st
index 91dbefd..0a91886 100644
--- a/src/Album/AlbTextCursorAttribute.class.st
+++ b/src/Album/AlbTextCursorAttribute.class.st
@@ -3,24 +3,22 @@ Allows users to react to the cursor movement within the editor.
 `AlbTextCursorAttributeExamples>>#changingForeground`
 "
 Class {
-	#name : 'AlbTextCursorAttribute',
-	#superclass : 'AlbTextCrappyEventHandlerAttribute',
+	#name : #AlbTextCursorAttribute,
+	#superclass : #AlbTextCrappyEventHandlerAttribute,
 	#instVars : [
 		'enterAction',
 		'leaveAction',
 		'isInside'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttribute >> enterAction [
 	^ enterAction
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttribute >> enterAction: aBlock [
 	"A Block in a form [ :aTextEditor :anEvent :aTextStart :aTextEnd | ]"
 	self 
@@ -30,7 +28,7 @@ AlbTextCursorAttribute >> enterAction: aBlock [
 	enterAction := aBlock
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextCursorAttribute >> handleEvent: anEvent [ 
 	"Handle a given event or dispatch it using #sendTo:"
 
@@ -41,7 +39,7 @@ AlbTextCursorAttribute >> handleEvent: anEvent [
 		ifTrue: [ self performLeaveAction: anEvent ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextCursorAttribute >> initialize [
 	super initialize.
 
@@ -50,12 +48,12 @@ AlbTextCursorAttribute >> initialize [
 	isInside := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttribute >> leaveAction [
 	^ leaveAction
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttribute >> leaveAction: aBlock [
 	"A Block in a form [ :aTextEditor :anEvent :aTextStart :aTextEnd | ]"
 	self 
@@ -65,7 +63,7 @@ AlbTextCursorAttribute >> leaveAction: aBlock [
 	leaveAction := aBlock
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextCursorAttribute >> performEnterAction: anEvent [
 
 	isInside = true ifTrue: [ ^ self ].
@@ -79,7 +77,7 @@ AlbTextCursorAttribute >> performEnterAction: anEvent [
 		value: anEvent attributeEnd
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextCursorAttribute >> performLeaveAction: anEvent [ 
 
 	isInside = false ifTrue: [ ^ self ].
@@ -93,7 +91,7 @@ AlbTextCursorAttribute >> performLeaveAction: anEvent [
 		value: anEvent attributeEnd
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextCursorAttribute >> wantsEvent: anEvent [ 
 	"Return true if I am interested in a given event and want to handle it,
 	false otherwise"
diff --git a/src/Album/AlbTextCursorAttributeEnterEvent.class.st b/src/Album/AlbTextCursorAttributeEnterEvent.class.st
index a5afc95..d58a9f7 100644
--- a/src/Album/AlbTextCursorAttributeEnterEvent.class.st
+++ b/src/Album/AlbTextCursorAttributeEnterEvent.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbTextCursorAttributeEnterEvent',
-	#superclass : 'AlbTextCursorAttributeEvent',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextCursorAttributeEnterEvent,
+	#superclass : #AlbTextCursorAttributeEvent,
+	#category : 'Album-Attributes - Support'
 }
diff --git a/src/Album/AlbTextCursorAttributeEvent.class.st b/src/Album/AlbTextCursorAttributeEvent.class.st
index e8aa445..0330f94 100644
--- a/src/Album/AlbTextCursorAttributeEvent.class.st
+++ b/src/Album/AlbTextCursorAttributeEvent.class.st
@@ -1,69 +1,67 @@
 Class {
-	#name : 'AlbTextCursorAttributeEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextCursorAttributeEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'interval',
 		'textualPiece',
 		'textEditor',
 		'wrappedEvent'
 	],
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> attributeEnd [
 	^ interval last
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> attributeStart [
 	^ interval first
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> interval [
 
 	^ interval
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> interval: anObject [
 
 	interval := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> textEditor [
 
 	^ textEditor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> textEditor: aTextEditor [
 
 	textEditor := aTextEditor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> textualPiece [
 
 	^ textualPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> textualPiece: aTextualPiece [
 
 	textualPiece := aTextualPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> wrappedEvent [
 	^ wrappedEvent ifNil: [ self ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextCursorAttributeEvent >> wrappedEvent: anEvent [
 
 	wrappedEvent := anEvent
diff --git a/src/Album/AlbTextCursorAttributeLeaveEvent.class.st b/src/Album/AlbTextCursorAttributeLeaveEvent.class.st
index bdfc043..c04a8fa 100644
--- a/src/Album/AlbTextCursorAttributeLeaveEvent.class.st
+++ b/src/Album/AlbTextCursorAttributeLeaveEvent.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbTextCursorAttributeLeaveEvent',
-	#superclass : 'AlbTextCursorAttributeEvent',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextCursorAttributeLeaveEvent,
+	#superclass : #AlbTextCursorAttributeEvent,
+	#category : 'Album-Attributes - Support'
 }
diff --git a/src/Album/AlbTextCursorAttributeMouseEvent.class.st b/src/Album/AlbTextCursorAttributeMouseEvent.class.st
index 1804658..fc6ba5b 100644
--- a/src/Album/AlbTextCursorAttributeMouseEvent.class.st
+++ b/src/Album/AlbTextCursorAttributeMouseEvent.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbTextCursorAttributeMouseEvent',
-	#superclass : 'AlbTextCursorAttributeEvent',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextCursorAttributeMouseEvent,
+	#superclass : #AlbTextCursorAttributeEvent,
+	#category : 'Album-Attributes - Support'
 }
diff --git a/src/Album/AlbTextDeletedEvent.class.st b/src/Album/AlbTextDeletedEvent.class.st
index 44826eb..9b5fd7b 100644
--- a/src/Album/AlbTextDeletedEvent.class.st
+++ b/src/Album/AlbTextDeletedEvent.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbTextDeletedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextDeletedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextDeletedEvent class >> from: aFromIndex to: aToIndex [
 	<return: #AlbTextDeletedEvent>
 
@@ -19,22 +17,22 @@ AlbTextDeletedEvent class >> from: aFromIndex to: aToIndex [
 		toIndex: aToIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextDeletedEvent >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextDeletedEvent >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextDeletedEvent >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextDeletedEvent >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditedEvent.class.st b/src/Album/AlbTextEditedEvent.class.st
index e8e6db1..e2a0cfd 100644
--- a/src/Album/AlbTextEditedEvent.class.st
+++ b/src/Album/AlbTextEditedEvent.class.st
@@ -1,26 +1,24 @@
 Class {
-	#name : 'AlbTextEditedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextEditedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'text'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditedEvent >> sendTo: anEventHandler [
 
 	anEventHandler textEditedEvent: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditedEvent >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditedEvent >> text: anObject [
 	text := anObject
 ]
diff --git a/src/Album/AlbTextEditor.class.st b/src/Album/AlbTextEditor.class.st
index a2c01d0..e9f43a0 100644
--- a/src/Album/AlbTextEditor.class.st
+++ b/src/Album/AlbTextEditor.class.st
@@ -3,8 +3,8 @@ I edit text and provide high level abstractions of essential text editor functio
 I subclass infinite data source in order to be able to smoothly display practically infinite amounts of text.
 "
 Class {
-	#name : 'AlbTextEditor',
-	#superclass : 'BlInfiniteDataSource',
+	#name : #AlbTextEditor,
+	#superclass : #BlInfiniteDataSource,
 	#classTraits : 'TObservable classTrait',
 	#instVars : [
 		'text',
@@ -22,29 +22,27 @@ Class {
 	#classInstVars : [
 		'isDebug'
 	],
-	#category : 'Album-Model',
-	#package : 'Album',
-	#tag : 'Model'
+	#category : 'Album-Model'
 }
 
-{ #category : 'cleanup' }
+{ #category : #cleanup }
 AlbTextEditor class >> cleanUp [
 	super cleanUp.
 	
 	isDebug := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor class >> isDebug [
 	^ isDebug ifNil: [ false ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor class >> isDebug: aBoolean [
 	isDebug := aBoolean
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> addEditorShortcut: aTextEditorShortcut [
 
 	self editorShortcuts
@@ -53,7 +51,7 @@ AlbTextEditor >> addEditorShortcut: aTextEditorShortcut [
 		ifReplaced: [ :aPreviousEditorShortcut | self onShortcutRemoved: aPreviousEditorShortcut ]
 ]
 
-{ #category : 'asserting' }
+{ #category : #asserting }
 AlbTextEditor >> assertUIProcess [
 	"I check if the current process is a UI process of all attached editor elements"
 	| aCurrentProcess myProcess |
@@ -66,18 +64,18 @@ AlbTextEditor >> assertUIProcess [
 				format: { aCurrentProcess asString . myProcess asString }) ].
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> cacheSize: anInteger [
 	segmentCollector cacheSize: anInteger
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> checkAndSetText: aText [ 
 	self checkText: aText.
 	self text: aText
 ]
 
-{ #category : 'text checking' }
+{ #category : #'text checking' }
 AlbTextEditor >> checkText: aText [
 
 	(aText allSatisfy: [ :aCharacter | 
@@ -86,12 +84,12 @@ AlbTextEditor >> checkText: aText [
 		ifFalse: [ ^ self error: 'Non printable character in text' ]
 ]
 
-{ #category : 'private - selection' }
+{ #category : #'private - selection' }
 AlbTextEditor >> commitSelection [
 	self selectionRecorder commit: self
 ]
 
-{ #category : 'text - copy/paste' }
+{ #category : #'text - copy/paste' }
 AlbTextEditor >> copy: aFromIndex to: aToIndex [
 
 	"Copy text within given text interval to the clipboard"
@@ -99,7 +97,7 @@ AlbTextEditor >> copy: aFromIndex to: aToIndex [
 	Clipboard clipboardText: (self privateText from: aFromIndex + 1 to: aToIndex) asString
 ]
 
-{ #category : 'text - copy/paste' }
+{ #category : #'text - copy/paste' }
 AlbTextEditor >> copySelected [
 	"Copy currently selected text to the clipboard"
 	
@@ -111,26 +109,26 @@ AlbTextEditor >> copySelected [
 		to: self selection to
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> cursor [
 	<return: #AlbTextEditorCursor>
 
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> cursor: aCursor [
 	<return: #AlbTextEditorCursor>
 
 	cursor := aCursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> cursors [
 	^  { self cursor } 
 ]
 
-{ #category : 'text - copy/paste' }
+{ #category : #'text - copy/paste' }
 AlbTextEditor >> cut: aFromIndex to: aToIndex [
 	"Copy text within given text interval to the clipboard and remove it from the editor.
 	Note: I update the cursor location and selection"
@@ -142,7 +140,7 @@ AlbTextEditor >> cut: aFromIndex to: aToIndex [
 	self delete: aFromIndex to: aToIndex
 ]
 
-{ #category : 'text - copy/paste' }
+{ #category : #'text - copy/paste' }
 AlbTextEditor >> cutSelected [
 	"Copy currently selected text to the clipboard and remove it from the editor.
 	Note: I update the cursor location and selection"
@@ -155,39 +153,39 @@ AlbTextEditor >> cutSelected [
 		to: self selection to
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> defaultCursor [
 	<return: #AlbTextEditorCursor>
 
 	^ AlbTextEditorSingleCursor new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> defaultSegmentCollector [
 	^ AlbTextEditorSegmentCollector new 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> defaultSelection [
 	<return: #BlSelection>
 
 	^ BlCompositeSelection new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> defaultSelectionRecorder [
 	<return: #AlbTextEditorSelectionRecorder>
 
 	^ AlbTextEditorSelectionOverwriteRecorder new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> defaultText [
 	<return: #BlText>
 	^ BlRopedText string: ''
 ]
 
-{ #category : 'private - text' }
+{ #category : #'private - text' }
 AlbTextEditor >> delete: aFromTextIndex to: aToTextIndex [
 	"I delete a piece of text within a given text interval without cursor or selection update.
 	Note: cursor or selection location after deletion may be invalid!"
@@ -199,12 +197,12 @@ AlbTextEditor >> delete: aFromTextIndex to: aToTextIndex [
 		delete
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> deleter [
 	^ AlbTextEditorDeleter new editor: self
 ]
 
-{ #category : 'private - text' }
+{ #category : #'private - text' }
 AlbTextEditor >> deselect: aFromTextIndex to: aToTextIndex [
 	"Deselect text within an interval defined by provided from and to indices without any other side effects.
 	Note:
@@ -216,38 +214,38 @@ AlbTextEditor >> deselect: aFromTextIndex to: aToTextIndex [
 		deselect
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> deselecter [
 	<return: #AlbTextEditorDeselecter>
 
 	^ AlbTextEditorDeselecter new editor: self
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> editorShortcuts [
 	<return: #AlbTextEditorShortcuts>
 
 	^ shortcuts
 ]
 
-{ #category : 'commands - processing' }
+{ #category : #'commands - processing' }
 AlbTextEditor >> enqueueCommand: aTextEditorCommand [
 	self deprecated: 'Use #executeCommand since there is not queue management and that the command is directly executed'.
 	self executeCommand: aTextEditorCommand
 ]
 
-{ #category : 'commands - processing' }
+{ #category : #'commands - processing' }
 AlbTextEditor >> enqueueHolderCommand: aTextEditorHolderCommand interval: aTextInterval [
 	self deprecated: 'use directly #notifyItems:event: instead'.
 
 ]
 
-{ #category : 'commands - processing' }
+{ #category : #'commands - processing' }
 AlbTextEditor >> executeCommand: aTextEditorCommand [
 	aTextEditorCommand executeOn: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> globalTextIndexToLocal: aTextIndex [
 
 	self segmentCollector
@@ -260,7 +258,7 @@ AlbTextEditor >> globalTextIndexToLocal: aTextIndex [
 	^ nil
 ]
 
-{ #category : 'text - selection' }
+{ #category : #'text - selection' }
 AlbTextEditor >> hasCursors [
 	"Return true of there is at least one cursor, false otherwise"
 	<return: #Boolean>
@@ -268,12 +266,12 @@ AlbTextEditor >> hasCursors [
 	^ self cursors isNotEmpty
 ]
 
-{ #category : 'event handler attributes' }
+{ #category : #'event handler attributes' }
 AlbTextEditor >> hasEventHandlerAttribute [
 	^ hasEventHandlerAttribute ifNil: [ false ]
 ]
 
-{ #category : 'text - selection' }
+{ #category : #'text - selection' }
 AlbTextEditor >> hasSelection [
 	"Return true of there is at least one selected character, false otherwise"
 	<return: #Boolean>
@@ -281,19 +279,19 @@ AlbTextEditor >> hasSelection [
 	^ self selection isNotEmpty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> history [
 	<return: #AlbTextEditorHistory>
 	
 	^ history
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> history: aTextEditorHistory [
 	history := aTextEditorHistory
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> initialize [
 
 	super initialize.
@@ -314,7 +312,7 @@ AlbTextEditor >> initialize [
 
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> initializeText: aText [
 
 	aText when: BlTextStringsInserted send: #onStringsInserted: to: self.
@@ -323,20 +321,20 @@ AlbTextEditor >> initializeText: aText [
 	aText when: BlTextAttributesRemoved send: #onTextAttributesRemoved: to: self
 ]
 
-{ #category : 'api - filter' }
+{ #category : #'api - filter' }
 AlbTextEditor >> inputFilter [
 	<return: #AlbTextEditorInputFilter>
 
 	^ filter
 ]
 
-{ #category : 'api - filter' }
+{ #category : #'api - filter' }
 AlbTextEditor >> inputFilter: aTextEditorInputFilter [
 
 	filter := aTextEditorInputFilter next: filter
 ]
 
-{ #category : 'private - text' }
+{ #category : #'private - text' }
 AlbTextEditor >> insertString: aString at: aTextIndex [
 
 	self inserter
@@ -348,39 +346,39 @@ AlbTextEditor >> insertString: aString at: aTextIndex [
 		insert
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> inserter [
 	^ AlbTextEditorInserter new editor: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> isFocused [
 	<return: #Boolean>
 
 	^ isFocused
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> itemCount [
 	^ segmentCollector computedSegmentsCount
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> itemIdAt: aPosition [
 	^ (segmentCollector segmentAt: aPosition) index
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> layoutPositionsRange [
 	^ layoutPositionsRange ifNil: [ 0 to: 0 ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> layoutPositionsRange: anInterval [
 	layoutPositionsRange := anInterval
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> limitedSurroundMap [
 	"When inserting some special symbols a text editor should surround a cursor or selection with that symbol"
 
@@ -397,7 +395,7 @@ AlbTextEditor >> limitedSurroundMap [
 		}
 ]
 
-{ #category : 'model protocol' }
+{ #category : #'model protocol' }
 AlbTextEditor >> modeChanged: aMode [
 
 	self deselecter
@@ -406,7 +404,7 @@ AlbTextEditor >> modeChanged: aMode [
 		notifyCursorRemoved
 ]
 
-{ #category : 'text - cursor' }
+{ #category : #'text - cursor' }
 AlbTextEditor >> moveCursorTo: aTextIndex [
 	"Moves cursor to a given position without any further action such as cancelling selection"
 	<event: #AlbCursorMovedEvent>
@@ -416,17 +414,17 @@ AlbTextEditor >> moveCursorTo: aTextIndex [
 		apply
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> navigator [
 	^ AlbTextEditorNavigator new editor: self
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditor >> newSegmentCollector [
 	^ self defaultSegmentCollector
 ]
 
-{ #category : 'private - cursor' }
+{ #category : #'private - cursor' }
 AlbTextEditor >> notifyAttributesWithinCursor: aCollectionOfAttributes [
 
 	"I select and notify those attributes in the given collection that are within any of the cursors"
@@ -445,47 +443,47 @@ AlbTextEditor >> notifyAttributesWithinCursor: aCollectionOfAttributes [
 				(eachAttribute wantsEvent: anEvent) ifTrue: [ eachAttribute handleEvent: anEvent ] ] ]
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyDeletedFrom: aFromIndex to: aToIndex [
 	self dispatchEvent: (AlbTextDeletedEvent new
 		fromIndex: aFromIndex;
 		toIndex: aToIndex)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyInserted: aText at: aTextIndex [
 	self dispatchEvent: (AlbTextInsertedEvent text: aText at: aTextIndex)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifySelectionChanged: aSelection [
 
 	self dispatchEvent: (AlbSelectionChangedEvent new selection: aSelection)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyShortcutAdded: aShortcut [
 	self dispatchEvent: (AlbShortcutAddedEvent new shortcut: aShortcut)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyShortcutRemoved: aShortcut [
 	self dispatchEvent: (AlbShortcutRemovedEvent new shortcut: aShortcut)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyTextEdited: aText [
 
 	self dispatchEvent: (AlbTextEditedEvent new text: aText)
 ]
 
-{ #category : 'event firing' }
+{ #category : #'event firing' }
 AlbTextEditor >> notifyTextReplaced: aText [
 
 	self dispatchEvent: (AlbTextReplacedEvent new text: aText)
 ]
 
-{ #category : 'hooks' }
+{ #category : #hooks }
 AlbTextEditor >> onAttached: anEditorElement [
 	"sent by the element (from dataSource: )"
 	
@@ -494,7 +492,7 @@ AlbTextEditor >> onAttached: anEditorElement [
 	self notifyChanged
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditor >> onBindHolder: aSegmentHolder at: aPosition [
 
 	"I bind a segment at a given position to the provided segment holder"
@@ -514,7 +512,7 @@ AlbTextEditor >> onBindHolder: aSegmentHolder at: aPosition [
 	self notifyItemsInserted: (aPosition + 1 to: aPosition + segmentCollector lastIndex - previousLastIndex)
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditor >> onCreateHolder: anEditorElement [ 
 	"Create and return a new segment holder of a given type to be used with provided editor element"
 	<return: #AlbEditorSegmentHolder>
@@ -523,7 +521,7 @@ AlbTextEditor >> onCreateHolder: anEditorElement [
 	^ AlbTextEditorLineSegmentHolder new
 ]
 
-{ #category : 'hooks' }
+{ #category : #hooks }
 AlbTextEditor >> onDetached: anEditorElement [
 
 	self removeEventHandlersSuchThat: [ :eventHandler | true ].
@@ -531,7 +529,7 @@ AlbTextEditor >> onDetached: anEditorElement [
 
 ]
 
-{ #category : 'private - focus' }
+{ #category : #'private - focus' }
 AlbTextEditor >> onGotFocus [
 
 	isFocused := true.
@@ -539,7 +537,7 @@ AlbTextEditor >> onGotFocus [
 	self executeCommand: (AlbTextEditorFocusChangedCommand new hasFocus: true)
 ]
 
-{ #category : 'private - focus' }
+{ #category : #'private - focus' }
 AlbTextEditor >> onLostFocus [
 	isFocused := false.
 
@@ -547,19 +545,19 @@ AlbTextEditor >> onLostFocus [
 	self executeCommand: (AlbTextEditorFocusChangedCommand new hasFocus: false).
 ]
 
-{ #category : 'hooks' }
+{ #category : #hooks }
 AlbTextEditor >> onShortcutAdded: aShortcut [
 
 	self notifyShortcutAdded: aShortcut
 ]
 
-{ #category : 'hooks' }
+{ #category : #hooks }
 AlbTextEditor >> onShortcutRemoved: aShortcut [
 
 	self notifyShortcutRemoved: aShortcut
 ]
 
-{ #category : 'hooks - text modifications' }
+{ #category : #'hooks - text modifications' }
 AlbTextEditor >> onStringsInserted: aBlTextStringsInserted [
 
 	"Is sent after a few strings (or one) are inserted in a text model"
@@ -580,7 +578,7 @@ AlbTextEditor >> onStringsInserted: aBlTextStringsInserted [
 	self notifyTextEdited: self privateText
 ]
 
-{ #category : 'hooks - text modifications' }
+{ #category : #'hooks - text modifications' }
 AlbTextEditor >> onTextAttributeAdded: aBlTextAttributeAdded [
 
 	self segmentCollector
@@ -598,7 +596,7 @@ AlbTextEditor >> onTextAttributeAdded: aBlTextAttributeAdded [
 	self notifyAttributesWithinCursor: { aBlTextAttributeAdded attribute }
 ]
 
-{ #category : 'hooks - text modifications' }
+{ #category : #'hooks - text modifications' }
 AlbTextEditor >> onTextAttributesRemoved: aBlTextAttributesRemoved [
 
 	self segmentCollector
@@ -610,7 +608,7 @@ AlbTextEditor >> onTextAttributesRemoved: aBlTextAttributesRemoved [
 		to: aBlTextAttributesRemoved toIndex
 ]
 
-{ #category : 'hooks - text modifications' }
+{ #category : #'hooks - text modifications' }
 AlbTextEditor >> onTextReplaced [
 
 	"Is sent after a text instance is replaced with a new one"
@@ -619,7 +617,7 @@ AlbTextEditor >> onTextReplaced [
 	self notifyTextReplaced: self privateText
 ]
 
-{ #category : 'hooks - text modifications' }
+{ #category : #'hooks - text modifications' }
 AlbTextEditor >> onTextsDeleted: aBlTextsDeleted [
 
 	"Is sent after a piece of text was deleted in a text model"
@@ -639,7 +637,7 @@ AlbTextEditor >> onTextsDeleted: aBlTextsDeleted [
 	self notifyTextEdited: self privateText
 ]
 
-{ #category : 'text - copy/paste' }
+{ #category : #'text - copy/paste' }
 AlbTextEditor >> paste [
 	"A paste a text from the clipboard at the current cursor position.
 	I delete any currently selected text and update cursor position"
@@ -650,17 +648,17 @@ AlbTextEditor >> paste [
 		paste
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> paster [
 	^ AlbTextEditorPaster new editor: self
 ]
 
-{ #category : 'private - selection' }
+{ #category : #'private - selection' }
 AlbTextEditor >> prepareSelection [
 	self selectionRecorder prepare: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> privateText [
 	"Return a current text in the text editor. All modification to the text
 	are reflected in the UI of the editor. For this reason I must only be
@@ -672,7 +670,7 @@ AlbTextEditor >> privateText [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> privateText: aText [ 
 
 	text == aText ifTrue: [ ^ self ].
@@ -681,7 +679,7 @@ AlbTextEditor >> privateText: aText [
 	self restoreText: aText
 ]
 
-{ #category : 'private - cursor' }
+{ #category : #'private - cursor' }
 AlbTextEditor >> processCursorAttributes [
 	"I search for the attributes within the whole text that contain (or not contain) any of the cursors and notify about it"
 	| anEnteredEvent aLeavedEvent eventHandlingAttributesOutside eventHandlingAttributesInside |
@@ -724,7 +722,7 @@ AlbTextEditor >> processCursorAttributes [
 			ifTrue: [ eachAttribute handleEvent: anEnteredEvent ] ]
 ]
 
-{ #category : 'private - selection' }
+{ #category : #'private - selection' }
 AlbTextEditor >> recordDeselection: aMonotoneTextSelection [
 	self selectionRecorder deselect: aMonotoneTextSelection in: self.
 	
@@ -734,7 +732,7 @@ AlbTextEditor >> recordDeselection: aMonotoneTextSelection [
 	self moveCursorTo: (self selection + self selectionRecorder selection) to
 ]
 
-{ #category : 'private - selection' }
+{ #category : #'private - selection' }
 AlbTextEditor >> recordSelection: aMonotoneTextSelection [
 	self selectionRecorder select: aMonotoneTextSelection in: self.
 
@@ -744,12 +742,12 @@ AlbTextEditor >> recordSelection: aMonotoneTextSelection [
 	self moveCursorTo: (self selection + self selectionRecorder selection) to
 ]
 
-{ #category : 'text - undo/redo' }
+{ #category : #'text - undo/redo' }
 AlbTextEditor >> redo [
 	history redoOn: self
 ]
 
-{ #category : 'event handler attributes' }
+{ #category : #'event handler attributes' }
 AlbTextEditor >> registerEventHandlerAttribute: anEventHandlerattribute from: aFromIndex to: aToIndex [
 	| eventHandlers |
 	hasEventHandlerAttribute := true.
@@ -758,31 +756,31 @@ AlbTextEditor >> registerEventHandlerAttribute: anEventHandlerattribute from: aF
 	eventHandlers do: [ :eachHandler | self addEventHandler: (BlEventForwarder forwardTo: eachHandler from: anEventHandlerattribute) ]	
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> removeAllEditorShortcuts [
 	self editorShortcuts
 		removeAllShortcutsAndDo: [ :aPreviousShortcut | self onShortcutRemoved: aPreviousShortcut ]
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> removeEditorShortcut: aTextEditorShortcut [
 	self editorShortcuts
 		remove: aTextEditorShortcut
 		ifFound: [ :aPreviousShortcut | self onShortcutRemoved: aPreviousShortcut ]
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> removeEditorShortcuts: aCollectionOfTextEditorShortcut [
 	aCollectionOfTextEditorShortcut do: [ :eachShortcut | self removeEditorShortcut: eachShortcut ]
 ]
 
-{ #category : 'api - save state' }
+{ #category : #'api - save state' }
 AlbTextEditor >> restoreState: aTextEditorMemento [
 
 	aTextEditorMemento restoreStateOf: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> restoreText: aText [
 
 	"before changing the text we must unsubscribe from existing one"
@@ -808,28 +806,28 @@ AlbTextEditor >> restoreText: aText [
 	self notifyChanged
 ]
 
-{ #category : 'api - save state' }
+{ #category : #'api - save state' }
 AlbTextEditor >> saveState [
 	<return: #AlbTextEditorMemento>
 	
 	^ (AlbTextEditorCompositeMemento new all) saveStateOf: self
 ]
 
-{ #category : 'api - save state' }
+{ #category : #'api - save state' }
 AlbTextEditor >> saveState: aTextEditorMemento [
 	<return: #AlbTextEditorMemento>
 	
 	^ aTextEditorMemento saveStateOf: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> segmentCollector [
 	<return: #AlbTextEditorSegmentCollector>
 
 	^ segmentCollector
 ]
 
-{ #category : 'private - text' }
+{ #category : #'private - text' }
 AlbTextEditor >> select: aFromTextIndex to: aToTextIndex [
 	"Select text within an interval defined by provided from and to indices without any other side effects.
 	Note:
@@ -842,7 +840,7 @@ AlbTextEditor >> select: aFromTextIndex to: aToTextIndex [
 		select
 ]
 
-{ #category : 'text - selection' }
+{ #category : #'text - selection' }
 AlbTextEditor >> selectNone [
 	"Deselect the whole text in the editor without any other side effects.
 	Note:
@@ -857,7 +855,7 @@ AlbTextEditor >> selectNone [
 		to: self selection to
 ]
 
-{ #category : 'text - selection' }
+{ #category : #'text - selection' }
 AlbTextEditor >> selectedText [
 
 	<return: #BlText>
@@ -866,35 +864,35 @@ AlbTextEditor >> selectedText [
 		  ifFalse: [ self privateText from: 1 to: 0]
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> selecter [
 	<return: #AlbTextEditorSelecter>
 
 	^ AlbTextEditorSelecter new editor: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> selection [
 	<return: #BlSelection>
 
 	^ selection
 ]
 
-{ #category : 'private - selection' }
+{ #category : #'private - selection' }
 AlbTextEditor >> selection: aTextSelection [
 	selection := aTextSelection.
 	
 	self notifySelectionChanged: selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> selectionRecorder [
 	<return: #AlbTextEditorSelectionRecorder>
 
 	^ selectionRecorder
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> setEditorShortcuts: aTextEditorShortcuts [
 
 	self removeAllEditorShortcuts.
@@ -902,7 +900,7 @@ AlbTextEditor >> setEditorShortcuts: aTextEditorShortcuts [
 	shortcuts do: [ :aNewEditorShortcut | self onShortcutAdded: aNewEditorShortcut ]
 ]
 
-{ #category : 'api - shortcuts' }
+{ #category : #'api - shortcuts' }
 AlbTextEditor >> surroundMap [
 	"When inserting some special symbols a text editor should surround a cursor or selection with that symbol"
 
@@ -921,7 +919,7 @@ AlbTextEditor >> surroundMap [
 		}
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> text [
 	"Return a current text in the text editor. All modification to the text
 	are reflected in the UI of the editor. For this reason I must only be
@@ -937,7 +935,7 @@ AlbTextEditor >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> text: aText [ 
 
 	self
@@ -949,7 +947,7 @@ AlbTextEditor >> text: aText [
 	self privateText: aText
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> textSnapshot [
 	"Return a snaphost (copy) of the current text.
 	I am safe to use from a non-UI thread because the returned text is independent from the
@@ -959,7 +957,7 @@ AlbTextEditor >> textSnapshot [
 	^ text copy
 ]
 
-{ #category : 'asserting' }
+{ #category : #asserting }
 AlbTextEditor >> uiProcess [
 
 	| element space |
@@ -973,21 +971,21 @@ AlbTextEditor >> uiProcess [
 	^ nil
 ]
 
-{ #category : 'text - undo/redo' }
+{ #category : #'text - undo/redo' }
 AlbTextEditor >> undo [
 	history undoOn: self
 ]
 
-{ #category : 'event handler attributes' }
+{ #category : #'event handler attributes' }
 AlbTextEditor >> unregisterEventHandlerAttribute: anEventHandlerattribute from: aFromIndex to: aToIndex [
 ]
 
-{ #category : 'event handler attributes' }
+{ #category : #'event handler attributes' }
 AlbTextEditor >> unregisterEventHandlerAttributesFrom: aFromIndex to: aToIndex [
 	Transcript show: 'unregisterEventHandlerAttributesFrom: ', aFromIndex printString, ' to: ', aToIndex printString; cr.
 ]
 
-{ #category : 'private - updating' }
+{ #category : #'private - updating' }
 AlbTextEditor >> updateSelection: aFromTextIndex to: aToTextIndex [
 	"Update text rendering within an interval defined by provided from and to indices."
 	| aCommand |
@@ -998,21 +996,21 @@ AlbTextEditor >> updateSelection: aFromTextIndex to: aToTextIndex [
 	self executeCommand: aCommand
 ]
 
-{ #category : 'api - modification' }
+{ #category : #'api - modification' }
 AlbTextEditor >> updater [
 	<return: #AlbTextEditorUpdater>
 
 	^ AlbTextEditorUpdater new editor: self
 ]
 
-{ #category : 'view configuration' }
+{ #category : #'view configuration' }
 AlbTextEditor >> whenTextEditedDo: aBlock [
 
 	self deprecated: 'Use directly when: AlbTextEditedEvent do: instead'. 
 	self when: AlbTextEditedEvent do: aBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditor >> withoutCacheLimit [
 	 self cacheSize: -1
 ]
diff --git a/src/Album/AlbTextEditorAbstractSegmentPiece.class.st b/src/Album/AlbTextEditorAbstractSegmentPiece.class.st
index 27446b3..012757c 100644
--- a/src/Album/AlbTextEditorAbstractSegmentPiece.class.st
+++ b/src/Album/AlbTextEditorAbstractSegmentPiece.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbTextEditorAbstractSegmentPiece',
-	#superclass : 'Object',
+	#name : #AlbTextEditorAbstractSegmentPiece,
+	#superclass : #Object,
 	#traits : 'TAlbTextEditorTextualPiece',
 	#classTraits : 'TAlbTextEditorTextualPiece classTrait',
 	#instVars : [
 		'segment',
 		'currentCursor'
 	],
-	#category : 'Album-Model-Segment',
-	#package : 'Album',
-	#tag : 'Model-Segment'
+	#category : 'Album-Model-Segment'
 }
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> addCursor: aPieceElement of: aLineSegment in: anEditorElement [
 	| globalCursor |
 	"if text editor cursor is currently within this segment piece then convert it to a local one"
@@ -25,14 +23,14 @@ AlbTextEditorAbstractSegmentPiece >> addCursor: aPieceElement of: aLineSegment i
 	self onCursorAdded: currentCursor to: aPieceElement in: anEditorElement
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorAbstractSegmentPiece >> createElement: anEditorElement [
 	<return: #BlElement>
 
 	^ self subclassResponsibility
 ]
 
-{ #category : 'api - cursor' }
+{ #category : #'api - cursor' }
 AlbTextEditorAbstractSegmentPiece >> currentCursor [
 	"local cursor within this segment piece"
 	<return: #AlbTextEditorSingleCursor>
@@ -40,14 +38,14 @@ AlbTextEditorAbstractSegmentPiece >> currentCursor [
 	^ currentCursor
 ]
 
-{ #category : 'api - cursor' }
+{ #category : #'api - cursor' }
 AlbTextEditorAbstractSegmentPiece >> currentCursor: aCursor [
 	"local cursor within this segment piece"
 	
 	currentCursor := aCursor
 ]
 
-{ #category : 'api - cursor' }
+{ #category : #'api - cursor' }
 AlbTextEditorAbstractSegmentPiece >> globalCursorToLocal: aSingleCursor [
 	"Convert a global cursor as specified in the editor to a local one"
 	<return: #AlbTextEditorSingleCursor>
@@ -59,7 +57,7 @@ AlbTextEditorAbstractSegmentPiece >> globalCursorToLocal: aSingleCursor [
 	^ aLocalCursor
 ]
 
-{ #category : 'api - cursor' }
+{ #category : #'api - cursor' }
 AlbTextEditorAbstractSegmentPiece >> globalTextIndexToLocal: aTextIndex [
 	"Convert global text index given in the text coordinates of the whole editor to a local index within this segment piece.
 	This convertion is necessary due to the fact that text elements that represent every segment piece work with text in their own local system"
@@ -70,12 +68,12 @@ AlbTextEditorAbstractSegmentPiece >> globalTextIndexToLocal: aTextIndex [
 		ifFalse: [ aTextIndex - self textStart ]
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorAbstractSegmentPiece >> isText [
 	^ false
 ]
 
-{ #category : 'cursor - hooks' }
+{ #category : #'cursor - hooks' }
 AlbTextEditorAbstractSegmentPiece >> onCursorAdded: aCursor to: aPieceElement in: anEditorElement [
 	"Is sent when a cursor is added to a given piece element within provided editor element"
 
@@ -86,7 +84,7 @@ AlbTextEditorAbstractSegmentPiece >> onCursorAdded: aCursor to: aPieceElement in
 			cursorPosition: aCursor position)
 ]
 
-{ #category : 'cursor - hooks' }
+{ #category : #'cursor - hooks' }
 AlbTextEditorAbstractSegmentPiece >> onCursorRemoved: aCursor from: aPieceElement in: anEditorElement [
 	"Is sent when a cursor is removed from a given piece element within provided editor element"
 	
@@ -96,7 +94,7 @@ AlbTextEditorAbstractSegmentPiece >> onCursorRemoved: aCursor from: aPieceElemen
 			cursorPosition: aCursor position)
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> removeCursor: aPieceElement of: aLineSegment in: anEditorElement [
 
 	currentCursor ifNil: [ ^ self ].
@@ -105,7 +103,7 @@ AlbTextEditorAbstractSegmentPiece >> removeCursor: aPieceElement of: aLineSegmen
 	currentCursor := nil
 ]
 
-{ #category : 'api - cursor' }
+{ #category : #'api - cursor' }
 AlbTextEditorAbstractSegmentPiece >> screenToCursor: aTransformation of: anEditorElement in: aPieceElement [
 
 	aPieceElement dispatchEvent:
@@ -114,17 +112,17 @@ AlbTextEditorAbstractSegmentPiece >> screenToCursor: aTransformation of: anEdito
 			editorElement: anEditorElement)
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorAbstractSegmentPiece >> segment [
 	^ segment
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorAbstractSegmentPiece >> segment: anObject [
 	segment := anObject
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> setCursor: aPieceElement of: aLineSegment in: anEditorElement [
 	| aFocusRequest localCursor globalCursor |
 	"get the global cursor "
@@ -146,7 +144,7 @@ AlbTextEditorAbstractSegmentPiece >> setCursor: aPieceElement of: aLineSegment i
 		dispatchEvent: (aFocusRequest editorElement: anEditorElement)
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> updateCursor: aPieceElement of: aLineSegment in: anEditorElement [
 	| globalCursor localCursor |
 self flag: 'to be checked because of failing tests AlbTextEditorNavigatorTest>>test_cursor_add_at_1_in_multiline'.
@@ -166,7 +164,7 @@ self flag: 'to be checked because of failing tests AlbTextEditorNavigatorTest>>t
 	currentCursor ifNotNil: [ self onCursorAdded: currentCursor to: aPieceElement in: anEditorElement ]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> updateFocus: hasFocus of: aTextPieceElement in: anEditorElement [
 	| aRequest |
 
@@ -177,7 +175,7 @@ AlbTextEditorAbstractSegmentPiece >> updateFocus: hasFocus of: aTextPieceElement
 	aTextPieceElement dispatchEvent: (aRequest editorElement: anEditorElement)
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> updateSelection: aTextElement of: aLineSegment in: anEditorElement [
 	| aTextEditor |
 
@@ -204,7 +202,7 @@ AlbTextEditorAbstractSegmentPiece >> updateSelection: aTextElement of: aLineSegm
 					toIndex: localTo) ] ]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorAbstractSegmentPiece >> updateText: aTextElement of: aLineSegment in: anEditorElement [
 
 	aTextElement dispatchEvent: (AlbTextEditorTextChangedRequest new
@@ -215,7 +213,7 @@ AlbTextEditorAbstractSegmentPiece >> updateText: aTextElement of: aLineSegment i
 		textEnd: self textEnd)
 ]
 
-{ #category : 'api - geometry' }
+{ #category : #'api - geometry' }
 AlbTextEditorAbstractSegmentPiece >> wordMargin [
 	<return: #BlInsets>
 	| aHalfOfLineSpacing |
@@ -227,7 +225,7 @@ AlbTextEditorAbstractSegmentPiece >> wordMargin [
 		bottom: (self segment lineSpacing - aHalfOfLineSpacing)
 ]
 
-{ #category : 'api - geometry' }
+{ #category : #'api - geometry' }
 AlbTextEditorAbstractSegmentPiece >> wordPadding [
 	<return: #BlInsets>
 		
diff --git a/src/Album/AlbTextEditorAlphaNumericInputFilter.class.st b/src/Album/AlbTextEditorAlphaNumericInputFilter.class.st
index a0edf49..e89c5c2 100644
--- a/src/Album/AlbTextEditorAlphaNumericInputFilter.class.st
+++ b/src/Album/AlbTextEditorAlphaNumericInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorAlphaNumericInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorAlphaNumericInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorAlphaNumericInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorBlurRequest.class.st b/src/Album/AlbTextEditorBlurRequest.class.st
index 3de1321..6f9163c 100644
--- a/src/Album/AlbTextEditorBlurRequest.class.st
+++ b/src/Album/AlbTextEditorBlurRequest.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbTextEditorBlurRequest',
-	#superclass : 'AlbTextEditorRequest',
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#name : #AlbTextEditorBlurRequest,
+	#superclass : #AlbTextEditorRequest,
+	#category : 'Album-UI-Requests'
 }
diff --git a/src/Album/AlbTextEditorClassNameInputFilter.class.st b/src/Album/AlbTextEditorClassNameInputFilter.class.st
index 42e9d69..eaa2989 100644
--- a/src/Album/AlbTextEditorClassNameInputFilter.class.st
+++ b/src/Album/AlbTextEditorClassNameInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorClassNameInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorClassNameInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorClassNameInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorCommand.class.st b/src/Album/AlbTextEditorCommand.class.st
index 9fc8c20..c692dc0 100644
--- a/src/Album/AlbTextEditorCommand.class.st
+++ b/src/Album/AlbTextEditorCommand.class.st
@@ -1,32 +1,30 @@
 Class {
-	#name : 'AlbTextEditorCommand',
-	#superclass : 'Object',
+	#name : #AlbTextEditorCommand,
+	#superclass : #Object,
 	#traits : 'TBlDebug',
 	#classTraits : 'TBlDebug classTrait',
 	#instVars : [
 		'context'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCommand >> context [
 	^ context
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCommand >> context: anObject [
 	context := anObject
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorCommand >> executeOn: aTextEditor [
 	self subclassResponsibility
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorCommand >> newHolderCommand [ 
 	self deprecated: 'use #newHolderEvent since I return an event'.
 
diff --git a/src/Album/AlbTextEditorCompositeMemento.class.st b/src/Album/AlbTextEditorCompositeMemento.class.st
index 7c2e812..f71880e 100644
--- a/src/Album/AlbTextEditorCompositeMemento.class.st
+++ b/src/Album/AlbTextEditorCompositeMemento.class.st
@@ -1,20 +1,18 @@
 Class {
-	#name : 'AlbTextEditorCompositeMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorCompositeMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'mementos'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> addMemento: aMemento [
 	mementos add: aMemento
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> all [
 	self
 		cursors;
@@ -26,95 +24,95 @@ AlbTextEditorCompositeMemento >> all [
 		text
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> cursors [
 	mementos add: AlbTextEditorCursorsMemento new
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> history [
 	mementos add: AlbTextEditorHistoryMemento new
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorCompositeMemento >> initialize [
 	super initialize.
 	
 	mementos := SortedCollection sortUsing: [ :a :b | a order < b order ]
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> inputFilter [
 	mementos add: AlbTextEditorInputFilterMemento new
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorCompositeMemento >> label [
 	^ 'Composite ({1})' format: { self mementos size }
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorCompositeMemento >> mementoOfType: aMementoType do: aBlock [
 	self mementos
 		detect: [ :eachMemento | eachMemento isKindOf: aMementoType ]
 		ifFound: aBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCompositeMemento >> mementos [
 	^ mementos 
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> mode [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCompositeMemento >> order [
 	^ self shouldNotImplement
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorCompositeMemento >> restoreStateOf: aTextEditor [
 	mementos do: [ :eachMemento | eachMemento restoreStateOf: aTextEditor ]
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorCompositeMemento >> saveStateOf: aTextEditor [
 	mementos do: [ :eachMemento | eachMemento saveStateOf: aTextEditor ]
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> selection [
 	mementos add: AlbTextEditorSelectionMemento new
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorCompositeMemento >> selectionDo: aBlock [
 	self
 		mementoOfType: AlbTextEditorSelectionMemento
 		do: [ :aSelectionMemento | aBlock value: aSelectionMemento selection ]
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> shortcuts [
 	mementos add: AlbTextEditorShortcutsMemento new
 ]
 
-{ #category : 'api - memento' }
+{ #category : #'api - memento' }
 AlbTextEditorCompositeMemento >> text [
 	mementos add: AlbTextEditorTextMemento new
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorCompositeMemento >> textDo: aBlock [
 	self
 		mementoOfType: AlbTextEditorTextMemento
 		do: [ :aTextMemento | aBlock value: aTextMemento value ]
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorCompositeMemento >> value [
 	^ self mementos
 ]
diff --git a/src/Album/AlbTextEditorCursor.class.st b/src/Album/AlbTextEditorCursor.class.st
index 1aca74d..69276b2 100644
--- a/src/Album/AlbTextEditorCursor.class.st
+++ b/src/Album/AlbTextEditorCursor.class.st
@@ -1,24 +1,22 @@
 Class {
-	#name : 'AlbTextEditorCursor',
-	#superclass : 'Object',
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#name : #AlbTextEditorCursor,
+	#superclass : #Object,
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorCursor class >> at: aTextIndex [
 	<return: #AlbTextEditorSingleCursor>
 
 	^ AlbTextEditorSingleCursor at: aTextIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursor >> allCursors [
 	^ Array streamContents: [ :aStream | self do: [ :aCursor | aStream nextPut: aCursor ] ]
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> allSatisfy: aBlock [
 	"Evaluate aBlock with all cursor.
 	If aBlock returns false for any element return false, otherwise return true"
@@ -29,7 +27,7 @@ AlbTextEditorCursor >> allSatisfy: aBlock [
 	^ true
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> anySatisfy: aBlock [
 	"Evaluate aBlock with all cursors.
 	If aBlock returns true for any element return true, otherwise return false"
@@ -40,13 +38,13 @@ AlbTextEditorCursor >> anySatisfy: aBlock [
 	^ false
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> collect: aBlock [ 	
 	^ Array streamContents: [ :aStream |
 		self do: [ :anElement | aStream nextPut: (aBlock value: anElement) ] ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursor >> cursorsCount [
 	<return: #Number>
 	| aCount |
@@ -56,7 +54,7 @@ AlbTextEditorCursor >> cursorsCount [
 	^ aCount
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> detect: aBlock [ 
 	"Evaluate aBlock with each of the receiver's elements as the argument. 
 	Answer the first element for which aBlock evaluates to true."
@@ -64,7 +62,7 @@ AlbTextEditorCursor >> detect: aBlock [
 	^ self detect: aBlock ifNone: [self errorNotFound: aBlock]
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> detect: aBlock ifFound: foundBlock [
 	"Evaluate aBlock with each of the receiver's elements as the argument.  
 	If some element evaluates aBlock to true, then cull this element into 
@@ -80,7 +78,7 @@ AlbTextEditorCursor >> detect: aBlock ifFound: foundBlock [
 			 ]
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> detect: aBlock ifFound: foundBlock ifNone: exceptionBlock [
 	"Evaluate aBlock with each of the receiver's elements as the argument.  
 	If some element evaluates aBlock to true, then cull this element into 
@@ -94,7 +92,7 @@ AlbTextEditorCursor >> detect: aBlock ifFound: foundBlock ifNone: exceptionBlock
 	^ exceptionBlock value	
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> detect: aBlock ifNone: exceptionBlock [
 	"Evaluate aBlock with each of the receiver's elements as the argument.  
 	Answer the first element for which aBlock evaluates to true. If none  
@@ -103,21 +101,21 @@ AlbTextEditorCursor >> detect: aBlock ifNone: exceptionBlock [
 	^ self detect: aBlock ifFound: [ :element | element ] ifNone: exceptionBlock
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> do: aBlock [
 	"Evaluate a given block with all available cursors"
 	
 	^ self subclassResponsibility
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> errorNotFound: anObject [
 	"Raise a NotFound exception."
 
 	NotFound signalFor: anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursor >> first [
 	"Return the first cursor sorted by position. Throw an error if there are no cursors"
 	<return: #AlbTextEditorSingleCursor>
@@ -125,7 +123,7 @@ AlbTextEditorCursor >> first [
 	^ (self allCursors sorted: [ :a :b | a position < b position ]) first
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorCursor >> isEmpty [
 	"Return true if there are no cursors"
 	<return: #Boolean>
@@ -134,7 +132,7 @@ AlbTextEditorCursor >> isEmpty [
 	^ true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorCursor >> isNotEmpty [
 	"Return true if there is at least one cursor"
 	<return: #Boolean>
@@ -142,7 +140,7 @@ AlbTextEditorCursor >> isNotEmpty [
 	^ self isEmpty not
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorCursor >> isSingle [
 	"Return true if there is exactly *one* cursor"
 	<return: #Boolean>
@@ -150,12 +148,12 @@ AlbTextEditorCursor >> isSingle [
 	^ self cursorsCount = 1
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursor >> positions [
 	^ self collect: [ :eachCursor | eachCursor position ]
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorCursor >> select: aBlock [ 	
 	^ Array streamContents: [ :aStream |
 			self do: [ :anElement |
diff --git a/src/Album/AlbTextEditorCursorAddCommand.class.st b/src/Album/AlbTextEditorCursorAddCommand.class.st
index f74872e..048d35a 100644
--- a/src/Album/AlbTextEditorCursorAddCommand.class.st
+++ b/src/Album/AlbTextEditorCursorAddCommand.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorCursorAddCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorCursorAddCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'cursor'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorAddCommand >> cursor [
 	<return: #AlbTextEditorSingleCursor>
 
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorAddCommand >> cursor: anObject [
 	cursor := anObject
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorCursorAddCommand >> executeOn: aTextEditor [
 
 	"Attribute handling: some attribute are eventHandlers."
@@ -37,12 +35,12 @@ AlbTextEditorCursorAddCommand >> executeOn: aTextEditor [
 		ifNotFound: [  ]
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorCursorAddCommand >> newHolderEvent [
 	^ AlbTextEditorCursorAddedHolderEvent new context: self context
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorCursorAddCommand >> processAttributesOn: aTextEditor [
 	| anEditorText thePotentialHandlerTextInterval theEventHandlingAttributes eventHandlingAttributesOutside eventHandlingAttributesInside |
 	self flag: 'what a crap!'.
diff --git a/src/Album/AlbTextEditorCursorAddedHolderEvent.class.st b/src/Album/AlbTextEditorCursorAddedHolderEvent.class.st
index 57a127c..f066139 100644
--- a/src/Album/AlbTextEditorCursorAddedHolderEvent.class.st
+++ b/src/Album/AlbTextEditorCursorAddedHolderEvent.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorCursorAddedHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#name : #AlbTextEditorCursorAddedHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorCursorAddedHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder onCursorAdded
 ]
diff --git a/src/Album/AlbTextEditorCursorIconHandler.class.st b/src/Album/AlbTextEditorCursorIconHandler.class.st
index 8680373..481de4d 100644
--- a/src/Album/AlbTextEditorCursorIconHandler.class.st
+++ b/src/Album/AlbTextEditorCursorIconHandler.class.st
@@ -1,24 +1,22 @@
 Class {
-	#name : 'AlbTextEditorCursorIconHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorCursorIconHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorCursorIconHandler >> dragEnterEvent: anEvent [
 
 	anEvent currentTarget mouseCursor: BlCursor default
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorCursorIconHandler >> dragLeaveEvent: anEvent [
 
 	anEvent currentTarget mouseCursor: BlCursor default
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorCursorIconHandler >> eventsToHandle [
 	^ {
 		BlDragEnterEvent.
@@ -29,7 +27,7 @@ AlbTextEditorCursorIconHandler >> eventsToHandle [
 	}
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorCursorIconHandler >> mouseEnterEvent: anEvent [
 
 	anEvent currentTarget mouseCursor: (element isEditable
@@ -37,13 +35,13 @@ AlbTextEditorCursorIconHandler >> mouseEnterEvent: anEvent [
 			 ifFalse: [ BlCursor default ])
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorCursorIconHandler >> mouseLeaveEvent: anEvent [
 
 	anEvent currentTarget mouseCursor: BlCursor default
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorCursorIconHandler >> mouseOverEvent: anEvent [
 
 	anEvent currentTarget mouseCursor: BlCursor overEditableText
diff --git a/src/Album/AlbTextEditorCursorRemoveCommand.class.st b/src/Album/AlbTextEditorCursorRemoveCommand.class.st
index 23dddf8..35461d5 100644
--- a/src/Album/AlbTextEditorCursorRemoveCommand.class.st
+++ b/src/Album/AlbTextEditorCursorRemoveCommand.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorCursorRemoveCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorCursorRemoveCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'cursor'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorRemoveCommand >> cursor [
 	<return: #AlbTextEditorSingleCursor>
 
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorRemoveCommand >> cursor: anObject [
 	cursor := anObject
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorCursorRemoveCommand >> executeOn: aTextEditor [
 
 	"Attribute handling: some attribute are eventHandlers."
@@ -37,12 +35,12 @@ AlbTextEditorCursorRemoveCommand >> executeOn: aTextEditor [
 		ifNotFound: [  ]
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorCursorRemoveCommand >> newHolderEvent [
 	^ AlbTextEditorCursorRemovedHolderEvent new context: self context
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorCursorRemoveCommand >> processAttributesOn: aTextEditor [
 	| anEditorText thePotentialHandlerTextInterval theEventHandlingAttributes eventHandlingAttributesOutside eventHandlingAttributesInside |
 	self flag: 'what a crap!'.
diff --git a/src/Album/AlbTextEditorCursorRemovedHolderEvent.class.st b/src/Album/AlbTextEditorCursorRemovedHolderEvent.class.st
index 00603f8..f8ba94c 100644
--- a/src/Album/AlbTextEditorCursorRemovedHolderEvent.class.st
+++ b/src/Album/AlbTextEditorCursorRemovedHolderEvent.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorCursorRemovedHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#name : #AlbTextEditorCursorRemovedHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorCursorRemovedHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder onCursorRemoved
 ]
diff --git a/src/Album/AlbTextEditorCursorsMemento.class.st b/src/Album/AlbTextEditorCursorsMemento.class.st
index e14009c..c5f8f78 100644
--- a/src/Album/AlbTextEditorCursorsMemento.class.st
+++ b/src/Album/AlbTextEditorCursorsMemento.class.st
@@ -1,37 +1,35 @@
 Class {
-	#name : 'AlbTextEditorCursorsMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorCursorsMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'cursors'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorsMemento >> cursors: anObject [
 	cursors := anObject
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorCursorsMemento >> initialize [
 	super initialize.
 	
 	cursors := AlbTextEditorMultipleCursor new
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorCursorsMemento >> label [
 	^ 'Cursors'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorCursorsMemento >> order [
 	^ 80
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorCursorsMemento >> restoreStateOf: aTextEditor [
 	aTextEditor navigator
 		withoutResettingDesiredCoordinate;
@@ -40,12 +38,12 @@ AlbTextEditorCursorsMemento >> restoreStateOf: aTextEditor [
 		apply
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorCursorsMemento >> saveStateOf: aTextEditor [
 	cursors := aTextEditor cursors copy
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorCursorsMemento >> value [
 	^ cursors
 ]
diff --git a/src/Album/AlbTextEditorDeleteCommand.class.st b/src/Album/AlbTextEditorDeleteCommand.class.st
index 9a387a6..aabb560 100644
--- a/src/Album/AlbTextEditorDeleteCommand.class.st
+++ b/src/Album/AlbTextEditorDeleteCommand.class.st
@@ -1,41 +1,39 @@
 Class {
-	#name : 'AlbTextEditorDeleteCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorDeleteCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorDeleteCommand >> executeOn: aTextEditor [
 
 	aTextEditor privateText delete: (self fromIndex + 1 min: self toIndex) to: self toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeleteCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeleteCommand >> fromIndex: aNumber [
 	<return: #Number>
 
 	fromIndex := aNumber
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeleteCommand >> toIndex [
 	<return: #Number>
 
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeleteCommand >> toIndex: aNumber [
 	toIndex := aNumber
 ]
diff --git a/src/Album/AlbTextEditorDeleter.class.st b/src/Album/AlbTextEditorDeleter.class.st
index 584fca2..eb62d79 100644
--- a/src/Album/AlbTextEditorDeleter.class.st
+++ b/src/Album/AlbTextEditorDeleter.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextEditorDeleter',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorDeleter,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'deletionIntervals',
 		'shouldUpdateCursor',
 		'shouldUpdateSelection'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> afterCursor [
 	"Delete all text after all cursors"
 
@@ -21,12 +19,12 @@ AlbTextEditorDeleter >> afterCursor [
 			to: self text size ]
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorDeleter >> apply [
 	^ self delete
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> beforeCursor [
 	"Delete all text before the cursors"
 		
@@ -36,14 +34,14 @@ AlbTextEditorDeleter >> beforeCursor [
 			to: aCursor position ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> computeCursorMovement: aCursor [
 	"Cumpute by how much a given cursor should be moved after text deletion within current deletion intervals"
 
 	^ self computeIndexMovement: aCursor position
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> computeIndexMovement: anIndex [
 	"Compute by how much a given text index should be moved after text deletion within current deletion intervals"
 	| aCursorDelta |
@@ -59,7 +57,7 @@ AlbTextEditorDeleter >> computeIndexMovement: anIndex [
 	^ aCursorDelta
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> computeSelectionMovement: aMonotoneSelection [
 	"Cumpute by how much a given selection should be moved after text deletion within current deletion intervals.
 	Note: a given monotone selection must not overlap with any deletion intervals"
@@ -76,7 +74,7 @@ AlbTextEditorDeleter >> computeSelectionMovement: aMonotoneSelection [
 	^ aSelectionDelta
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorDeleter >> delete [
 	"Perform deletion operation"
 
@@ -89,7 +87,7 @@ AlbTextEditorDeleter >> delete [
 	deletionIntervals reverseDo: [ :aMonotoneSelection | self privateDelete: aMonotoneSelection from to: aMonotoneSelection to]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> from: aFromIndex to: aToIndex [
 	"Mark a text interval given by from an to indices as the one to be deleted in cursor coordinates"
 
@@ -99,7 +97,7 @@ AlbTextEditorDeleter >> from: aFromIndex to: aToIndex [
 	deletionIntervals select: aFromIndex to: aToIndex
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorDeleter >> initialize [
 	super initialize.
 	
@@ -108,12 +106,12 @@ AlbTextEditorDeleter >> initialize [
 	shouldUpdateSelection := true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorDeleter >> isDeleter [
 	^ true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> oneAfterCursor [
 	"Delete one symbol after the cursors"
 		
@@ -123,7 +121,7 @@ AlbTextEditorDeleter >> oneAfterCursor [
 			to: ((aCursor position + 1) min: self text size) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> oneAfterCursorIfOutsideOfSelection [
 	"Delete one symbol after the cursors but only if there is no selection nearby"
 		
@@ -135,14 +133,14 @@ AlbTextEditorDeleter >> oneAfterCursorIfOutsideOfSelection [
 					to: ((aCursor position + 1) min: self text size) ] ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> oneBeforeCursor [
 	"Delete one symbol before the cursor"
 
 	self cursor do: [ :aCursor | self oneBeforeCursor: aCursor ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> oneBeforeCursor: aCursor [
 	"Delete one symbol before the specified cursor "
 
@@ -151,7 +149,7 @@ AlbTextEditorDeleter >> oneBeforeCursor: aCursor [
 		to: aCursor position
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> oneBeforeCursorIfOutsideOfSelection [
 	"Delete one symbol before the cursor but only if there is no selection nearby"
 
@@ -160,7 +158,7 @@ AlbTextEditorDeleter >> oneBeforeCursorIfOutsideOfSelection [
 			ifFalse: [ self oneBeforeCursor: aCursor ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> privateDelete: aFromTextIndex to: aToTextIndex [
 
 	"I delete a piece of text within a given text interval without cursor or selection update.
@@ -181,14 +179,14 @@ AlbTextEditorDeleter >> privateDelete: aFromTextIndex to: aToTextIndex [
 	self editor executeCommand: aCommand
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> selected [
 	"Mark currenty selected text as the one to be deleted"
 
 	self selection do: [ :aMonotoneSelection | self from: aMonotoneSelection from to: aMonotoneSelection to ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> surroundings: aDictionaryOrArray [
 	"Delete the surrounding around each cursor (if there is any) but only if the cursor is not part of the selection"
 	| theAssociations |
@@ -211,7 +209,7 @@ AlbTextEditorDeleter >> surroundings: aDictionaryOrArray [
 							to: aCursor position + aReplacement value size ] ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> updateCursors [
 	
 	self cursor do: [ :aCursor |
@@ -224,7 +222,7 @@ AlbTextEditorDeleter >> updateCursors [
 				apply ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeleter >> updateSelection [
 	| aSelectionCopy newSelection |
 	
@@ -243,12 +241,12 @@ AlbTextEditorDeleter >> updateSelection [
 	self editor selection: newSelection
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> withoutCursorUpdate [
 	shouldUpdateCursor := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeleter >> withoutSelectionUpdate [
 	shouldUpdateSelection := false
 ]
diff --git a/src/Album/AlbTextEditorDeselectCommand.class.st b/src/Album/AlbTextEditorDeselectCommand.class.st
index 73ab6f0..f28144e 100644
--- a/src/Album/AlbTextEditorDeselectCommand.class.st
+++ b/src/Album/AlbTextEditorDeselectCommand.class.st
@@ -2,18 +2,16 @@
 I deselect an interval of text from `fromIndex` to `toIndex`
 "
 Class {
-	#name : 'AlbTextEditorDeselectCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorDeselectCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorDeselectCommand >> executeOn: aTextEditor [
 
 	aTextEditor selection isEmpty
@@ -24,22 +22,22 @@ AlbTextEditorDeselectCommand >> executeOn: aTextEditor [
 	aTextEditor notifySelectionChanged: aTextEditor selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectCommand >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectCommand >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectCommand >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditorDeselectRequest.class.st b/src/Album/AlbTextEditorDeselectRequest.class.st
index ced3bbd..1f8c110 100644
--- a/src/Album/AlbTextEditorDeselectRequest.class.st
+++ b/src/Album/AlbTextEditorDeselectRequest.class.st
@@ -1,31 +1,29 @@
 Class {
-	#name : 'AlbTextEditorDeselectRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorDeselectRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectRequest >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectRequest >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectRequest >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDeselectRequest >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditorDeselecter.class.st b/src/Album/AlbTextEditorDeselecter.class.st
index 52ab3d2..16bae44 100644
--- a/src/Album/AlbTextEditorDeselecter.class.st
+++ b/src/Album/AlbTextEditorDeselecter.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorDeselecter',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorDeselecter,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'selection'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeselecter >> all [
 	"Deselect the whole text"
 
 	self selection do: [ :aMonotoneSelection | self from: aMonotoneSelection from to: aMonotoneSelection to ]
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorDeselecter >> apply [
 	^ self deselect
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorDeselecter >> deselect [
 
 	selection do: [ :aMonotoneSelection | 
@@ -33,19 +31,19 @@ AlbTextEditorDeselecter >> deselect [
 
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorDeselecter >> from: aFromIndex to: aToIndex [
 	selection select: aFromIndex to: aToIndex
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorDeselecter >> initialize [
 	super initialize.
 
 	selection := BlCompositeSelection new
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorDeselecter >> outsideOfCursor [
 	"Remove all selections that don't contain any existing cursor"
 
@@ -55,7 +53,7 @@ AlbTextEditorDeselecter >> outsideOfCursor [
 				ifFalse: [ self from: aMonotoneSelection from to: aMonotoneSelection to ] ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorDeselecter >> privateDeselect: aFromTextIndex to: aToTextIndex [
 	"Deselect text within an interval defined by provided from and to indices without any other side effects.
 	Note:
diff --git a/src/Album/AlbTextEditorDigitInputFilter.class.st b/src/Album/AlbTextEditorDigitInputFilter.class.st
index d925234..9ffb801 100644
--- a/src/Album/AlbTextEditorDigitInputFilter.class.st
+++ b/src/Album/AlbTextEditorDigitInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorDigitInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorDigitInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorDigitInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorDoubleClickHandler.class.st b/src/Album/AlbTextEditorDoubleClickHandler.class.st
index ac0493b..1168491 100644
--- a/src/Album/AlbTextEditorDoubleClickHandler.class.st
+++ b/src/Album/AlbTextEditorDoubleClickHandler.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorDoubleClickHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorDoubleClickHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorDoubleClickHandler >> doubleClickEvent: anEvent [
 
 	| screenPosition globalTextIndex selecter navigator editor selection |
@@ -67,7 +65,7 @@ AlbTextEditorDoubleClickHandler >> doubleClickEvent: anEvent [
 		apply
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorDoubleClickHandler >> eventsToHandle [
 
 	^ { BlDoubleClickEvent }
diff --git a/src/Album/AlbTextEditorExplicitScreenToCursorTransformation.class.st b/src/Album/AlbTextEditorExplicitScreenToCursorTransformation.class.st
index 93b6a80..032dbcc 100644
--- a/src/Album/AlbTextEditorExplicitScreenToCursorTransformation.class.st
+++ b/src/Album/AlbTextEditorExplicitScreenToCursorTransformation.class.st
@@ -1,30 +1,28 @@
 Class {
-	#name : 'AlbTextEditorExplicitScreenToCursorTransformation',
-	#superclass : 'AlbTextEditorScreenToCursorTransformation',
+	#name : #AlbTextEditorExplicitScreenToCursorTransformation,
+	#superclass : #AlbTextEditorScreenToCursorTransformation,
 	#instVars : [
 		'screenPosition'
 	],
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorExplicitScreenToCursorTransformation >> evaluateOn: anObject [
 	anObject explicitScreenToCursor: self
 ]
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorExplicitScreenToCursorTransformation >> evaluateOn: anObject for: anEvent [
 	anObject explicitScreenToCursor: self for: anEvent
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorExplicitScreenToCursorTransformation >> screenPosition [
 	^ screenPosition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorExplicitScreenToCursorTransformation >> screenPosition: anObject [
 	screenPosition := anObject
 ]
diff --git a/src/Album/AlbTextEditorFocusChangedCommand.class.st b/src/Album/AlbTextEditorFocusChangedCommand.class.st
index 96d0c74..d5a2af0 100644
--- a/src/Album/AlbTextEditorFocusChangedCommand.class.st
+++ b/src/Album/AlbTextEditorFocusChangedCommand.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorFocusChangedCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorFocusChangedCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'hasFocus'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorFocusChangedCommand >> executeOn: aTextEditor [
 	
 	"send to all visible segment holders"
@@ -17,17 +15,17 @@ AlbTextEditorFocusChangedCommand >> executeOn: aTextEditor [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorFocusChangedCommand >> hasFocus [
 	^ hasFocus
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorFocusChangedCommand >> hasFocus: anObject [
 	hasFocus := anObject
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorFocusChangedCommand >> newHolderEvent [
 	^ AlbTextEditorFocusChangedHolderEvent new
 		hasFocus: self hasFocus
diff --git a/src/Album/AlbTextEditorFocusChangedHolderEvent.class.st b/src/Album/AlbTextEditorFocusChangedHolderEvent.class.st
index 687afd9..1eecd0d 100644
--- a/src/Album/AlbTextEditorFocusChangedHolderEvent.class.st
+++ b/src/Album/AlbTextEditorFocusChangedHolderEvent.class.st
@@ -2,27 +2,25 @@
 I trigger a focus state update in the text piece
 "
 Class {
-	#name : 'AlbTextEditorFocusChangedHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
+	#name : #AlbTextEditorFocusChangedHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
 	#instVars : [
 		'hasFocus'
 	],
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorFocusChangedHolderEvent >> hasFocus [
 	^ hasFocus
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorFocusChangedHolderEvent >> hasFocus: aBoolean [
 	hasFocus := aBoolean
 ]
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorFocusChangedHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder onFocusChanged: self hasFocus
 ]
diff --git a/src/Album/AlbTextEditorFocusHandler.class.st b/src/Album/AlbTextEditorFocusHandler.class.st
index 4efd7e3..2f958b8 100644
--- a/src/Album/AlbTextEditorFocusHandler.class.st
+++ b/src/Album/AlbTextEditorFocusHandler.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbTextEditorFocusHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorFocusHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorFocusHandler >> blurEvent: anEvent [
 
 	element onLostFocus
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorFocusHandler >> eventsToHandle [
 
 	^ { 
@@ -20,7 +18,7 @@ AlbTextEditorFocusHandler >> eventsToHandle [
 		  BlBlurEvent }
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorFocusHandler >> focusEvent: anEvent [
 
 	element onGotFocus
diff --git a/src/Album/AlbTextEditorFocusRequest.class.st b/src/Album/AlbTextEditorFocusRequest.class.st
index 61d014e..254968d 100644
--- a/src/Album/AlbTextEditorFocusRequest.class.st
+++ b/src/Album/AlbTextEditorFocusRequest.class.st
@@ -1,7 +1,5 @@
 Class {
-	#name : 'AlbTextEditorFocusRequest',
-	#superclass : 'AlbTextEditorRequest',
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#name : #AlbTextEditorFocusRequest,
+	#superclass : #AlbTextEditorRequest,
+	#category : 'Album-UI-Requests'
 }
diff --git a/src/Album/AlbTextEditorHandler.class.st b/src/Album/AlbTextEditorHandler.class.st
index 211169a..19dd328 100644
--- a/src/Album/AlbTextEditorHandler.class.st
+++ b/src/Album/AlbTextEditorHandler.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorHandler >> eventsToHandle [
 
 	^ { 
@@ -16,26 +14,26 @@ AlbTextEditorHandler >> eventsToHandle [
 		  AlbTextEditedEvent }
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorHandler >> shortcutAddedEvent: anEvent [
 
 	element removeShortcutsWithCombination: anEvent shortcut combination.
 	element addShortcut: anEvent shortcut asShortcut
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorHandler >> shortcutRemovedEvent: anEvent [
 
 	element removeShortcutsWithCombination: anEvent shortcut combination
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorHandler >> textEditedEvent: anEvent [
 
 	element textEdited
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorHandler >> textReplacedEvent: anEvent [
 
 	
diff --git a/src/Album/AlbTextEditorHideCursorRequest.class.st b/src/Album/AlbTextEditorHideCursorRequest.class.st
index bd3016c..32c0925 100644
--- a/src/Album/AlbTextEditorHideCursorRequest.class.st
+++ b/src/Album/AlbTextEditorHideCursorRequest.class.st
@@ -1,22 +1,20 @@
 Class {
-	#name : 'AlbTextEditorHideCursorRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorHideCursorRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'cursorPosition'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHideCursorRequest >> cursorPosition [
 	<return: #Number>
 
 	^ cursorPosition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHideCursorRequest >> cursorPosition: aNumber [
 	
 	self
diff --git a/src/Album/AlbTextEditorHistory.class.st b/src/Album/AlbTextEditorHistory.class.st
index 032ac67..adf89b5 100644
--- a/src/Album/AlbTextEditorHistory.class.st
+++ b/src/Album/AlbTextEditorHistory.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbTextEditorHistory',
-	#superclass : 'Object',
+	#name : #AlbTextEditorHistory,
+	#superclass : #Object,
 	#instVars : [
 		'undoCommands',
 		'redoCommands',
@@ -8,12 +8,10 @@ Class {
 		'shouldGroup',
 		'currentGroup'
 	],
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#category : 'Album-History'
 }
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorHistory >> addCommand: aCommand [
 	isEnabled
 		ifFalse: [ ^ self ].
@@ -24,14 +22,14 @@ AlbTextEditorHistory >> addCommand: aCommand [
 	redoCommands removeAll
 ]
 
-{ #category : 'api - history' }
+{ #category : #'api - history' }
 AlbTextEditorHistory >> cursorsMovedFrom: aCollectionOfFromIndices to: aCollectionOfToIndices [
 	self addCommand: (AlbTextEditorHistoryCursorMovementCommand new
 		fromIndices: aCollectionOfFromIndices;
 		toIndices: aCollectionOfToIndices)
 ]
 
-{ #category : 'api - history' }
+{ #category : #'api - history' }
 AlbTextEditorHistory >> deletedTexts: aCollectionOfTexts undo: aCollectionOfUndoIndices redo: aCollectionOfRedoIndices [
 	self addCommand: (AlbTextEditorHistoryDeletionCommand new
 		texts: aCollectionOfTexts;
@@ -39,7 +37,7 @@ AlbTextEditorHistory >> deletedTexts: aCollectionOfTexts undo: aCollectionOfUndo
 		redoIndices: aCollectionOfRedoIndices)
 ]
 
-{ #category : 'api - history' }
+{ #category : #'api - history' }
 AlbTextEditorHistory >> disableDuring: aBlock [
 	| wasEnabled |
 	
@@ -49,7 +47,7 @@ AlbTextEditorHistory >> disableDuring: aBlock [
 	aBlock ensure: [ isEnabled := wasEnabled ]
 ]
 
-{ #category : 'api - history' }
+{ #category : #'api - history' }
 AlbTextEditorHistory >> groupDuring: aBlock [
 	| wasGrouped |
 	
@@ -72,14 +70,14 @@ AlbTextEditorHistory >> groupDuring: aBlock [
 							undoCommands addAll: theCommands ] ] ] ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorHistory >> initialize [
 	super initialize.
 	
 	self setUpToStart 
 ]
 
-{ #category : 'api - history' }
+{ #category : #'api - history' }
 AlbTextEditorHistory >> insertedStrings: aCollectionOfStrings undo: aCollectionOfUndoIndices redo: aCollectionOfRedoIndices [
 	self addCommand: (AlbTextEditorHistoryInsertionCommand new
 		strings: aCollectionOfStrings;
@@ -87,13 +85,13 @@ AlbTextEditorHistory >> insertedStrings: aCollectionOfStrings undo: aCollectionO
 		redoIndices: aCollectionOfRedoIndices)
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistory >> redoOn: aTextEditor [
 	redoCommands ifNotEmpty: [ :theCommands |
 		self disableDuring: [ undoCommands add: (theCommands removeLast redoOn: aTextEditor) ] ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorHistory >> setUpToStart [
 
 	undoCommands := OrderedCollection new.
@@ -106,7 +104,7 @@ AlbTextEditorHistory >> setUpToStart [
 	currentGroup := AlbTextEditorHistoryCompositeCommand new
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistory >> undoOn: aTextEditor [
 	undoCommands ifNotEmpty: [ :theCommands |
 		self disableDuring: [ redoCommands add: (theCommands removeLast undoOn: aTextEditor) ] ]
diff --git a/src/Album/AlbTextEditorHistoryCommand.class.st b/src/Album/AlbTextEditorHistoryCommand.class.st
index 4f33ef6..0ca16bf 100644
--- a/src/Album/AlbTextEditorHistoryCommand.class.st
+++ b/src/Album/AlbTextEditorHistoryCommand.class.st
@@ -1,22 +1,20 @@
 Class {
-	#name : 'AlbTextEditorHistoryCommand',
-	#superclass : 'Object',
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#name : #AlbTextEditorHistoryCommand,
+	#superclass : #Object,
+	#category : 'Album-History'
 }
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorHistoryCommand >> isGroup [
 	^ false
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCommand >> redoOn: aTextEditor [
 	self subclassResponsibility
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCommand >> undoOn: aTextEditor [
 	self subclassResponsibility
 ]
diff --git a/src/Album/AlbTextEditorHistoryCompositeCommand.class.st b/src/Album/AlbTextEditorHistoryCompositeCommand.class.st
index 30f995b..e8a4173 100644
--- a/src/Album/AlbTextEditorHistoryCompositeCommand.class.st
+++ b/src/Album/AlbTextEditorHistoryCompositeCommand.class.st
@@ -2,46 +2,44 @@
 Sometimes multiple commands should be grouped in one undo/redo sequence
 "
 Class {
-	#name : 'AlbTextEditorHistoryCompositeCommand',
-	#superclass : 'AlbTextEditorHistoryCommand',
+	#name : #AlbTextEditorHistoryCompositeCommand,
+	#superclass : #AlbTextEditorHistoryCommand,
 	#instVars : [
 		'commands'
 	],
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#category : 'Album-History'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorHistoryCompositeCommand >> addCommand: aCommand [
 	"Commands should be added in the order they are performed in the editor"
 
 	commands add: aCommand
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryCompositeCommand >> commands [
 	^ commands
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorHistoryCompositeCommand >> initialize [
 	super initialize.
 	
 	commands := OrderedCollection new
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorHistoryCompositeCommand >> isGroup [
 	^ true
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCompositeCommand >> redoOn: aTextEditor [
 	commands do: [ :eachCommand | eachCommand redoOn: aTextEditor ]
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCompositeCommand >> undoOn: aTextEditor [
 	commands reverseDo: [ :eachCommand | eachCommand undoOn: aTextEditor ]
 ]
diff --git a/src/Album/AlbTextEditorHistoryCursorMovementCommand.class.st b/src/Album/AlbTextEditorHistoryCursorMovementCommand.class.st
index 01ce1dc..a557698 100644
--- a/src/Album/AlbTextEditorHistoryCursorMovementCommand.class.st
+++ b/src/Album/AlbTextEditorHistoryCursorMovementCommand.class.st
@@ -1,26 +1,24 @@
 Class {
-	#name : 'AlbTextEditorHistoryCursorMovementCommand',
-	#superclass : 'AlbTextEditorHistoryCommand',
+	#name : #AlbTextEditorHistoryCursorMovementCommand,
+	#superclass : #AlbTextEditorHistoryCommand,
 	#instVars : [
 		'fromIndices',
 		'toIndices'
 	],
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#category : 'Album-History'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryCursorMovementCommand >> fromIndices [
 	^ fromIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryCursorMovementCommand >> fromIndices: anObject [
 	fromIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCursorMovementCommand >> redoOn: aTextEditor [
 	| aNavigator |
 	
@@ -30,17 +28,17 @@ AlbTextEditorHistoryCursorMovementCommand >> redoOn: aTextEditor [
 	aNavigator apply
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryCursorMovementCommand >> toIndices [
 	^ toIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryCursorMovementCommand >> toIndices: anObject [
 	toIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryCursorMovementCommand >> undoOn: aTextEditor [
 	| aNavigator |
 	
diff --git a/src/Album/AlbTextEditorHistoryDeletionCommand.class.st b/src/Album/AlbTextEditorHistoryDeletionCommand.class.st
index 7e4464c..267ea65 100644
--- a/src/Album/AlbTextEditorHistoryDeletionCommand.class.st
+++ b/src/Album/AlbTextEditorHistoryDeletionCommand.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorHistoryDeletionCommand',
-	#superclass : 'AlbTextEditorHistoryCommand',
+	#name : #AlbTextEditorHistoryDeletionCommand,
+	#superclass : #AlbTextEditorHistoryCommand,
 	#instVars : [
 		'texts',
 		'undoIndices',
 		'redoIndices'
 	],
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#category : 'Album-History'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> redoIndices [
 	^ redoIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> redoIndices: anObject [
 	redoIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryDeletionCommand >> redoOn: aTextEditor [
 	| aDeleter |
 	aTextEditor deselecter all deselect.
@@ -34,27 +32,27 @@ AlbTextEditorHistoryDeletionCommand >> redoOn: aTextEditor [
 	aDeleter delete
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> texts [
 	^ texts
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> texts: anObject [
 	texts := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> undoIndices [
 	^ undoIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryDeletionCommand >> undoIndices: anObject [
 	undoIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryDeletionCommand >> undoOn: aTextEditor [
 	| anInserter |
 	aTextEditor deselecter all deselect.
diff --git a/src/Album/AlbTextEditorHistoryInsertionCommand.class.st b/src/Album/AlbTextEditorHistoryInsertionCommand.class.st
index 03fb79c..a77de0c 100644
--- a/src/Album/AlbTextEditorHistoryInsertionCommand.class.st
+++ b/src/Album/AlbTextEditorHistoryInsertionCommand.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorHistoryInsertionCommand',
-	#superclass : 'AlbTextEditorHistoryCommand',
+	#name : #AlbTextEditorHistoryInsertionCommand,
+	#superclass : #AlbTextEditorHistoryCommand,
 	#instVars : [
 		'strings',
 		'undoIndices',
 		'redoIndices'
 	],
-	#category : 'Album-History',
-	#package : 'Album',
-	#tag : 'History'
+	#category : 'Album-History'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> redoIndices [
 	^ redoIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> redoIndices: anObject [
 	redoIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryInsertionCommand >> redoOn: aTextEditor [
 	| anInserter |
 	aTextEditor deselecter all deselect.
@@ -33,27 +31,27 @@ AlbTextEditorHistoryInsertionCommand >> redoOn: aTextEditor [
 	anInserter insert
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> strings [
 	^ strings
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> strings: anObject [
 	strings := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> undoIndices [
 	^ undoIndices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryInsertionCommand >> undoIndices: anObject [
 	undoIndices := anObject
 ]
 
-{ #category : 'api - undo/redo' }
+{ #category : #'api - undo/redo' }
 AlbTextEditorHistoryInsertionCommand >> undoOn: aTextEditor [
 	| aDeleter |
 	aTextEditor deselecter all deselect.
diff --git a/src/Album/AlbTextEditorHistoryMemento.class.st b/src/Album/AlbTextEditorHistoryMemento.class.st
index ee9e33f..1b5e364 100644
--- a/src/Album/AlbTextEditorHistoryMemento.class.st
+++ b/src/Album/AlbTextEditorHistoryMemento.class.st
@@ -1,42 +1,40 @@
 Class {
-	#name : 'AlbTextEditorHistoryMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorHistoryMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'history'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorHistoryMemento >> initialize [
 	super initialize.
 	
 	history := AlbTextEditorHistory new
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorHistoryMemento >> label [
 	^ 'History'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHistoryMemento >> order [
 	^ 30
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorHistoryMemento >> restoreStateOf: aTextEditor [
 	aTextEditor history: history
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorHistoryMemento >> saveStateOf: aTextEditor [
 	history := aTextEditor history
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorHistoryMemento >> value [
 	^ history
 ]
diff --git a/src/Album/AlbTextEditorHolderEvent.class.st b/src/Album/AlbTextEditorHolderEvent.class.st
index 4c6ad7a..a54f8f8 100644
--- a/src/Album/AlbTextEditorHolderEvent.class.st
+++ b/src/Album/AlbTextEditorHolderEvent.class.st
@@ -2,32 +2,30 @@
 I am a payload to trigger partial text update without re-creation of text pieces
 "
 Class {
-	#name : 'AlbTextEditorHolderEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextEditorHolderEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'context'
 	],
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHolderEvent >> context [
 	^ context
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorHolderEvent >> context: anObject [
 	context := anObject
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorHolderEvent >> executeOn: aSegmentHolder [
 	self deprecated: 'use #sendTo: instead since I''m an event'.
 ]
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorHolderEvent >> sendTo: aSegmentHolder [
 	self executeOn: aSegmentHolder
 ]
diff --git a/src/Album/AlbTextEditorInputFilter.class.st b/src/Album/AlbTextEditorInputFilter.class.st
index 3213c9a..6137885 100644
--- a/src/Album/AlbTextEditorInputFilter.class.st
+++ b/src/Album/AlbTextEditorInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorInputFilter',
-	#superclass : 'Object',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorInputFilter,
+	#superclass : #Object,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorInputFilterDecorator.class.st b/src/Album/AlbTextEditorInputFilterDecorator.class.st
index 1a25b46..ed048ef 100644
--- a/src/Album/AlbTextEditorInputFilterDecorator.class.st
+++ b/src/Album/AlbTextEditorInputFilterDecorator.class.st
@@ -1,34 +1,32 @@
 Class {
-	#name : 'AlbTextEditorInputFilterDecorator',
-	#superclass : 'AlbTextEditorInputFilter',
+	#name : #AlbTextEditorInputFilterDecorator,
+	#superclass : #AlbTextEditorInputFilter,
 	#instVars : [
 		'next'
 	],
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorInputFilterDecorator class >> next: aFilter [
 
 	^ self new filter: aFilter
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInputFilterDecorator >> filter: aString [
 
 	<return: #String>
 	^ self next ifNil: [ aString ] ifNotNil: [ :n | n filter: aString ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInputFilterDecorator >> next [
 
 	^ next
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInputFilterDecorator >> next: aFilter [
 
 	next := aFilter
diff --git a/src/Album/AlbTextEditorInputFilterMemento.class.st b/src/Album/AlbTextEditorInputFilterMemento.class.st
index 386cc44..2971d7d 100644
--- a/src/Album/AlbTextEditorInputFilterMemento.class.st
+++ b/src/Album/AlbTextEditorInputFilterMemento.class.st
@@ -1,42 +1,40 @@
 Class {
-	#name : 'AlbTextEditorInputFilterMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorInputFilterMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'inputFilter'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorInputFilterMemento >> initialize [
 	super initialize.
 	
 	inputFilter := AlbTextEditorNoInputFilter new
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorInputFilterMemento >> label [
 	^ 'Input filter'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInputFilterMemento >> order [
 	^ 50
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorInputFilterMemento >> restoreStateOf: aTextEditor [
 	aTextEditor inputFilter: inputFilter
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorInputFilterMemento >> saveStateOf: aTextEditor [
 	inputFilter := aTextEditor inputFilter
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorInputFilterMemento >> value [
 	^ inputFilter
 ]
diff --git a/src/Album/AlbTextEditorInsertStringsCommand.class.st b/src/Album/AlbTextEditorInsertStringsCommand.class.st
index 249a4ca..3d13781 100644
--- a/src/Album/AlbTextEditorInsertStringsCommand.class.st
+++ b/src/Album/AlbTextEditorInsertStringsCommand.class.st
@@ -1,37 +1,35 @@
 Class {
-	#name : 'AlbTextEditorInsertStringsCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorInsertStringsCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'strings',
 		'indices'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorInsertStringsCommand >> executeOn: aTextEditor [
 
 	aTextEditor privateText insertStrings: self strings atAll: self indices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInsertStringsCommand >> indices [
 	^ indices
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInsertStringsCommand >> indices: anObject [
 	indices := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInsertStringsCommand >> strings [
 	^ strings
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInsertStringsCommand >> strings: anObject [
 	strings := anObject
 ]
diff --git a/src/Album/AlbTextEditorInserter.class.st b/src/Album/AlbTextEditorInserter.class.st
index 8b68b3b..e50d1e4 100644
--- a/src/Album/AlbTextEditorInserter.class.st
+++ b/src/Album/AlbTextEditorInserter.class.st
@@ -12,8 +12,8 @@ anEditor
 
 "
 Class {
-	#name : 'AlbTextEditorInserter',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorInserter,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'insertionIndices',
 		'text',
@@ -23,17 +23,15 @@ Class {
 		'inputFilter',
 		'surroundMap'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorInserter >> apply [
 	^ self insert
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> at: anIndex [
 	"Add a given index as another text insertion location"
 
@@ -42,18 +40,18 @@ AlbTextEditorInserter >> at: anIndex [
 		ifNone: [ insertionIndices add: (anIndex -> text) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> atCursor [
 	self cursor do: [ :aCursor | self at: aCursor position ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> atEnd [
 	"Insert a text at the very end"
 	self at: self text size
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> beforeSelectedLines [
 	"We insert text at the beginning of all selected lines"
 	| aCollectionOfLineStarts |
@@ -67,7 +65,7 @@ AlbTextEditorInserter >> beforeSelectedLines [
 	aCollectionOfLineStarts asSet do: [ :anIndex | self at: anIndex ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> computeIndexMovement: anIndex afterInserted: aText at: anInsertionIndex [
 	"Compute by how much a given text index should be moved after a privided text is inserted at a given insertion index"
 	<return: #Number>
@@ -77,7 +75,7 @@ AlbTextEditorInserter >> computeIndexMovement: anIndex afterInserted: aText at:
 		ifFalse: [ aText size ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> computeSelection: aSelection afterInserted: aText at: anInsertionIndex [
 	<return: #BlSelection>
 
@@ -94,7 +92,7 @@ AlbTextEditorInserter >> computeSelection: aSelection afterInserted: aText at: a
 		to: aSelection to + aText size
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> crLineEndingWithWhitespace [
 	"Insert a Cr line ending
 	additionally adding a whitespace from the previous line according to a cursor"
@@ -104,7 +102,7 @@ AlbTextEditorInserter >> crLineEndingWithWhitespace [
 		ifFalse: [ String cr, (self findWhitespaceOfLineBefore: self cursor first position) ])
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> deleteSelectedText [
 	| aDeleter newInsertionIndices |
 	
@@ -122,14 +120,14 @@ AlbTextEditorInserter >> deleteSelectedText [
 	aDeleter delete
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> indentation [
 	"Insert an indentation (Tab)"
 
 	self text: String tab
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorInserter >> initialize [
 	super initialize.
 	
@@ -147,13 +145,13 @@ AlbTextEditorInserter >> initialize [
 	inputFilter := AlbTextEditorNoInputFilter new
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> inputFilter: aTextEditorInputFilter [
 
 	inputFilter := aTextEditorInputFilter
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorInserter >> insert [
 
 	| theFilteredTextMap theInsertions theCursorMovements |
@@ -269,19 +267,19 @@ AlbTextEditorInserter >> insert [
 					self updateSelectionAfterInsertion: (eachInsertion at: #string) at: (eachInsertion at: #requestedIndex) ] ] ]
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorInserter >> isInserter [
 	^ true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> lineEnding [
 	"Insert a line ending (Cr, Lf or CrLf depending on the current platform)"
 
 	self text: OSPlatform current lineEnding
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> lineEndingWithWhitespace [
 	"Insert a line ending (Cr, Lf or CrLf depending on the current platform)
 	additionally  adding a whitespace from the previous line according to a cursor"
@@ -291,22 +289,22 @@ AlbTextEditorInserter >> lineEndingWithWhitespace [
 		ifFalse: [ OSPlatform current lineEnding, (self findWhitespaceOfLineBefore: self cursor first position) ])
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> onlyAlphaNumeric [
 	self inputFilter: AlbTextEditorAlphaNumericInputFilter new
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> onlyDigits [
 	self inputFilter: AlbTextEditorDigitInputFilter new
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> onlyLetters [
 	self inputFilter: AlbTextEditorLetterInputFilter new
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateComputeCursorIndices: aString withSurround: aSurroundString at: aTextIndex [
 	| aLeftIndex aRightIndex |
 
@@ -321,7 +319,7 @@ AlbTextEditorInserter >> privateComputeCursorIndices: aString withSurround: aSur
 	^ { aLeftIndex . aRightIndex }
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateComputeInsertionIndices: aString withSurround: aSurroundString at: aTextIndex [
 	| aLeftIndex aRightIndex |
 
@@ -336,7 +334,7 @@ AlbTextEditorInserter >> privateComputeInsertionIndices: aString withSurround: a
 	^ { aLeftIndex . aRightIndex }
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateComputeSelectionIndices: aString withSurround: aSurroundString at: aTextIndex [
 	| aLeftIndex aRightIndex |
 
@@ -351,7 +349,7 @@ AlbTextEditorInserter >> privateComputeSelectionIndices: aString withSurround: a
 	^ { aLeftIndex . aRightIndex }
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateInsertStrings: aCollectionOfString atAll: aCollectionOfIndices [
 	| aCommand |
 
@@ -362,7 +360,7 @@ AlbTextEditorInserter >> privateInsertStrings: aCollectionOfString atAll: aColle
 	editor executeCommand: aCommand
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateUpdateCursorsAfterInsertion: aText at: anIndex [
 	self cursor do: [ :aCursor |
 		| aCursorDelta |
@@ -382,7 +380,7 @@ AlbTextEditorInserter >> privateUpdateCursorsAfterInsertion: aText at: anIndex [
 					apply ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> privateUpdateCursorsAfterInsertion: aText withSurround: aSurroundText at: aTextIndex [
 	| theIndices |
 
@@ -408,47 +406,47 @@ AlbTextEditorInserter >> privateUpdateCursorsAfterInsertion: aText withSurround:
 				apply ] ]
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldDeleteSelected [
 	^ shouldDeleteSelected
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldDeleteSelected: aBoolean [
 	shouldDeleteSelected := aBoolean
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldUpdateCursor [
 	^ shouldUpdateCursor
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldUpdateCursor: anObject [
 	shouldUpdateCursor := anObject
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldUpdateSelection [
 	^ shouldUpdateSelection
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorInserter >> shouldUpdateSelection: anObject [
 	shouldUpdateSelection := anObject
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> string: aString [
 	self text: aString
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> surroundings: aSurroundMap [
 	surroundMap := aSurroundMap
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> text: aBlText [
 
 	editor checkText: aBlText.
@@ -457,7 +455,7 @@ AlbTextEditorInserter >> text: aBlText [
 		eachAssociation value ifNil: [ eachAssociation value: text ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> updateSelectionAfterInsertion: aText at: anIndex [
 	| anExistingSelection |
 
@@ -472,7 +470,7 @@ AlbTextEditorInserter >> updateSelectionAfterInsertion: aText at: anIndex [
 				editor select: aNewSelection from to: aNewSelection to ] ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorInserter >> updateSelectionAfterInsertion: aText withSurround: aSurroundText at: aTextIndex [
 	| anExistingSelection theIndices |
 	
@@ -490,22 +488,22 @@ AlbTextEditorInserter >> updateSelectionAfterInsertion: aText withSurround: aSur
 				editor select: aNewSelection from to: aNewSelection to ] ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> withSelectionDelete [
 	shouldDeleteSelected := true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> withoutCursorUpdate [
 	shouldUpdateCursor := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> withoutSelectionDelete [
 	shouldDeleteSelected := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorInserter >> withoutSelectionUpdate [
 	shouldUpdateSelection := false
 ]
diff --git a/src/Album/AlbTextEditorInsertionHandler.class.st b/src/Album/AlbTextEditorInsertionHandler.class.st
index 06c3b1c..02f1dfc 100644
--- a/src/Album/AlbTextEditorInsertionHandler.class.st
+++ b/src/Album/AlbTextEditorInsertionHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextEditorInsertionHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorInsertionHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorInsertionHandler >> eventsToHandle [
 	^ { BlTextInputEvent }
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorInsertionHandler >> insert: aString atCursorIn: anEditor context: anElement [
 
 	anEditor surroundMap
@@ -35,7 +33,7 @@ AlbTextEditorInsertionHandler >> insert: aString atCursorIn: anEditor context: a
 				insert ]
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorInsertionHandler >> textInputEvent: anEvent [
 
 	"we don't want to insert anything if primary modifier key is pressed.
diff --git a/src/Album/AlbTextEditorInvalidateCommand.class.st b/src/Album/AlbTextEditorInvalidateCommand.class.st
index f9ee48d..5095f10 100644
--- a/src/Album/AlbTextEditorInvalidateCommand.class.st
+++ b/src/Album/AlbTextEditorInvalidateCommand.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbTextEditorInvalidateCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorInvalidateCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorInvalidateCommand >> executeOn: aTextEditor [
 
 	| changedFrom changedTo |
@@ -31,27 +29,27 @@ AlbTextEditorInvalidateCommand >> executeOn: aTextEditor [
 	aTextEditor notifyItems: (changedFrom to: changedTo) event: self newHolderEvent
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInvalidateCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInvalidateCommand >> fromIndex: aFromTextIndex [
 	fromIndex := aFromTextIndex
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorInvalidateCommand >> newHolderEvent [
 	^ AlbTextEditorTextChangedHolderEvent new
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInvalidateCommand >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorInvalidateCommand >> toIndex: aToTextIndex [
 	toIndex := aToTextIndex
 ]
diff --git a/src/Album/AlbTextEditorLetterInputFilter.class.st b/src/Album/AlbTextEditorLetterInputFilter.class.st
index ce4c275..9dc7c80 100644
--- a/src/Album/AlbTextEditorLetterInputFilter.class.st
+++ b/src/Album/AlbTextEditorLetterInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorLetterInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorLetterInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLetterInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorLineSegment.class.st b/src/Album/AlbTextEditorLineSegment.class.st
index daef3a6..796b833 100644
--- a/src/Album/AlbTextEditorLineSegment.class.st
+++ b/src/Album/AlbTextEditorLineSegment.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbTextEditorLineSegment',
-	#superclass : 'AlbTextEditorSegment',
+	#name : #AlbTextEditorLineSegment,
+	#superclass : #AlbTextEditorSegment,
 	#instVars : [
 		'pieces',
 		'lineSpacing',
 		'wordPadding',
 		'paragraphMargin'
 	],
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'pieces - computation' }
+{ #category : #'pieces - computation' }
 AlbTextEditorLineSegment >> clearCache [
 	"Clear all caches and make this segment fresh as if it would just be created and initalized"
 	super clearCache.
@@ -20,28 +18,28 @@ AlbTextEditorLineSegment >> clearCache [
 	pieces := nil
 ]
 
-{ #category : 'pieces - computation' }
+{ #category : #'pieces - computation' }
 AlbTextEditorLineSegment >> computedPieces [
 
 	<return: #SequenceableCollection of:	#AlbTextEditorAbstractSegmentPiece>
 	^ self newSplitter splitSegment: self
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorLineSegment >> hasPieces [
 	<return: #Boolean>
 
 	^ pieces isNotNil
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegment >> initialize [
 	super initialize.
 
 	self resetProperties
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorLineSegment >> isLastTextPiece: aSegmentPiece [
 	<return: #Boolean>
 	
@@ -54,19 +52,19 @@ AlbTextEditorLineSegment >> isLastTextPiece: aSegmentPiece [
 	^ false
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> lineSpacing [
 	<return: #Number>
 
 	^ lineSpacing
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> lineSpacing: aNumber [
 	lineSpacing := aNumber
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorLineSegment >> moveTextBy: aNumber [
 	super moveTextBy: aNumber.
 
@@ -78,7 +76,7 @@ AlbTextEditorLineSegment >> moveTextBy: aNumber [
 		do: [ :aTextPiece | aTextPiece start: aTextPiece textStart + aNumber end: aTextPiece textEnd + aNumber ]
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorLineSegment >> moveTextPiecesBy: aNumber at: aTextIndex [
 	"aTextIndex is a Text index, not a cursor one!"
 	| aCursorIndex |
@@ -123,26 +121,26 @@ AlbTextEditorLineSegment >> moveTextPiecesBy: aNumber at: aTextIndex [
 										end: aCursorIndex + ((aTextPiece textEnd - aCursorIndex - aNumber abs) max: 0) ] ] ] ]
 ]
 
-{ #category : 'pieces - computation' }
+{ #category : #'pieces - computation' }
 AlbTextEditorLineSegment >> newSplitter [
 
 	^ AlbTextEditorLineSegmentSplitter new
 		  beSeparatorBased; yourself
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> paragraphMargin [
 	<return: #BlInsets>
 
 	^ paragraphMargin
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> paragraphMargin: aBlInsets [
 	paragraphMargin := aBlInsets
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegment >> pieces [
 	<return: #Array of: #AlbTextEditorAbstractSegmentPiece>
 
@@ -151,14 +149,14 @@ AlbTextEditorLineSegment >> pieces [
 		ifFalse: [ pieces := self computedPieces ]
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegment >> resetProperties [
 	lineSpacing := 0.
 	wordPadding := BlInsets empty.
 	paragraphMargin := BlInsets empty.
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorLineSegment >> updateSegmentProperties [
 	| theParagraphAttributes |
 	
@@ -169,14 +167,14 @@ AlbTextEditorLineSegment >> updateSegmentProperties [
 		aParagraphAttribute applyOn: self ]
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> wordPadding [
 	<return: #BlInsets>
 
 	^ wordPadding
 ]
 
-{ #category : 'attributes - paragraph' }
+{ #category : #'attributes - paragraph' }
 AlbTextEditorLineSegment >> wordPadding: aBlInsets [
 	wordPadding := aBlInsets
 ]
diff --git a/src/Album/AlbTextEditorLineSegmentHolder.class.st b/src/Album/AlbTextEditorLineSegmentHolder.class.st
index 8deddff..602898f 100644
--- a/src/Album/AlbTextEditorLineSegmentHolder.class.st
+++ b/src/Album/AlbTextEditorLineSegmentHolder.class.st
@@ -2,8 +2,8 @@
 I am a line segment holder and is responsible for binding `AlbTextEditorLineSegment` with corresponding visual element
 "
 Class {
-	#name : 'AlbTextEditorLineSegmentHolder',
-	#superclass : 'AlbEditorSegmentHolder',
+	#name : #AlbTextEditorLineSegmentHolder,
+	#superclass : #AlbEditorSegmentHolder,
 	#instVars : [
 		'segment',
 		'pieceElements'
@@ -11,29 +11,27 @@ Class {
 	#classInstVars : [
 		'defaultSegmentLayoutBlock'
 	],
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'cleanup' }
+{ #category : #cleanup }
 AlbTextEditorLineSegmentHolder class >> cleanUp [
 	super cleanUp.
 	
 	defaultSegmentLayoutBlock := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder class >> defaultSegmentLayout [
 	^ (defaultSegmentLayoutBlock ifNil: [ AlbLineFlowLayout new ]) value
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder class >> defaultSegmentLayout: aBlock [
 	defaultSegmentLayoutBlock := aBlock
 ]
 
-{ #category : 'private - segment' }
+{ #category : #'private - segment' }
 AlbTextEditorLineSegmentHolder >> buildSegment: anEditorSegment [
 
 	| newPieceElements thePieces hasSelection hasCursor |
@@ -88,14 +86,14 @@ AlbTextEditorLineSegmentHolder >> buildSegment: anEditorSegment [
 		padding: anEditorSegment paragraphMargin
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorLineSegmentHolder >> cachedPieces [
 	<return: #Collection of: #AlbTextEditorAbstractSegmentPiece>
 	
 	^ pieceElements allPieces
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegmentHolder >> createSegmentElement [
 	<return: #BlElement>
 
@@ -109,7 +107,7 @@ AlbTextEditorLineSegmentHolder >> createSegmentElement [
 		yourself
 ]
 
-{ #category : 'cursor' }
+{ #category : #cursor }
 AlbTextEditorLineSegmentHolder >> explicitScreenToCursor: aTransformation [
 
 	| aBoundsInEditor aPositionInSegment aClosestPieceElement aClosestPiece aTransformedScreenPosition |
@@ -145,7 +143,7 @@ AlbTextEditorLineSegmentHolder >> explicitScreenToCursor: aTransformation [
 	aClosestPiece screenToCursor: aTransformation of: self infiniteElement in: aClosestPieceElement
 ]
 
-{ #category : 'private - testing' }
+{ #category : #'private - testing' }
 AlbTextEditorLineSegmentHolder >> hasCursor [
 
 	| aTextEditor |
@@ -153,7 +151,7 @@ AlbTextEditorLineSegmentHolder >> hasCursor [
 	^ aTextEditor cursor insideSegment: segment
 ]
 
-{ #category : 'private - testing' }
+{ #category : #'private - testing' }
 AlbTextEditorLineSegmentHolder >> hasSelection [
 	| aTextEditor textInterval |
 
@@ -167,12 +165,12 @@ AlbTextEditorLineSegmentHolder >> hasSelection [
 	^ false
 ]
 
-{ #category : 'private - segment' }
+{ #category : #'private - segment' }
 AlbTextEditorLineSegmentHolder >> newPiecesMap [
 	^ AlbTextEditorLineSegmentPieceMap new
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorLineSegmentHolder >> onCursorAdded [
 
 	"Is sent when text editor's cursor changes.
@@ -185,7 +183,7 @@ AlbTextEditorLineSegmentHolder >> onCursorAdded [
 			in: self infiniteElement]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorLineSegmentHolder >> onCursorRemoved [
 
 	"Is sent when text editor's cursor changes.
@@ -198,7 +196,7 @@ AlbTextEditorLineSegmentHolder >> onCursorRemoved [
 			in: self infiniteElement]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorLineSegmentHolder >> onFocusChanged: aBoolean [
 	"Is sent when text editor's focus state changes.
 	Segment holder should update text elements accordingly"
@@ -211,7 +209,7 @@ AlbTextEditorLineSegmentHolder >> onFocusChanged: aBoolean [
 		aPiece updateFocus: aBoolean of: aPieceElement in: self infiniteElement ]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorLineSegmentHolder >> onSelectionChanged [
 	"Is sent when text editor's selection changes.
 	Segment holder should update text elements accordingly"
@@ -224,7 +222,7 @@ AlbTextEditorLineSegmentHolder >> onSelectionChanged [
 		aPiece updateSelection: aPieceElement of: segment in: self infiniteElement ]
 ]
 
-{ #category : 'updating' }
+{ #category : #updating }
 AlbTextEditorLineSegmentHolder >> onTextChanged [
 
 	"Is sent when text changed in the editor (for example style attributes).
@@ -241,22 +239,22 @@ AlbTextEditorLineSegmentHolder >> onTextChanged [
 			in: self infiniteElement ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> pieceForElement: aBlElement ifAbsent: anAbsentBlock [
 	^ pieceElements pieceForElement: aBlElement ifAbsent: anAbsentBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> pieceForElement: aBlElement ifPresent: aBlock ifAbsent: anAbsentBlock [
 	^ pieceElements pieceForElement: aBlElement ifPresent: aBlock ifAbsent: anAbsentBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> piecesAndTheirElementsDo: aBlock [
 	pieceElements piecesAndTheirElementsDo: aBlock
 ]
 
-{ #category : 'cursor' }
+{ #category : #cursor }
 AlbTextEditorLineSegmentHolder >> relativeScreenToCursor: aTransformation [	
 	"trying to find a segment that actually contains a given position"
 
@@ -266,17 +264,17 @@ AlbTextEditorLineSegmentHolder >> relativeScreenToCursor: aTransformation [
 				^ aPiece screenToCursor: aTransformation of: self infiniteElement in: aPieceElement ] ]
 ]
 
-{ #category : 'cursor' }
+{ #category : #cursor }
 AlbTextEditorLineSegmentHolder >> screenToCursor: aTransformation [
 	aTransformation evaluateOn: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> segment [
 	^ segment 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> segment: anEditorSegment [
 	segment == anEditorSegment
 		ifTrue: [
@@ -284,12 +282,12 @@ AlbTextEditorLineSegmentHolder >> segment: anEditorSegment [
 	self buildSegment: anEditorSegment
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentHolder >> textInterval [ 
 	^ (segment textStart + 1 min: segment textEnd) to: segment textEnd
 ]
 
-{ #category : 'private - segment' }
+{ #category : #'private - segment' }
 AlbTextEditorLineSegmentHolder >> updateSegment: anEditorSegment [
 
 	| newPieceElements newPieceMap thePieces |
diff --git a/src/Album/AlbTextEditorLineSegmentPieceMap.class.st b/src/Album/AlbTextEditorLineSegmentPieceMap.class.st
index 5f902d2..6570702 100644
--- a/src/Album/AlbTextEditorLineSegmentPieceMap.class.st
+++ b/src/Album/AlbTextEditorLineSegmentPieceMap.class.st
@@ -1,22 +1,20 @@
 Class {
-	#name : 'AlbTextEditorLineSegmentPieceMap',
-	#superclass : 'Object',
+	#name : #AlbTextEditorLineSegmentPieceMap,
+	#superclass : #Object,
 	#instVars : [
 		'map'
 	],
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> allPieces [
 	"Return all current line segment pieces"
 	
 	^ map keys
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> at: aBrTextEditorLineSegmentPiece pieceAndElementsDo: thePieceAndElementsBlock ifAbsent: anAbsentBlock [
 
 	^ map
@@ -28,13 +26,13 @@ AlbTextEditorLineSegmentPieceMap >> at: aBrTextEditorLineSegmentPiece pieceAndEl
 		ifAbsent: anAbsentBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> atPiece: aTextEditorLineSegmentPiece putElements: aCollectionOfElements [
 
 	map at: aTextEditorLineSegmentPiece put: aCollectionOfElements
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegmentPieceMap >> initialize [
 
 	super initialize.
@@ -42,7 +40,7 @@ AlbTextEditorLineSegmentPieceMap >> initialize [
 	map := Dictionary new
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> pieceForElement: aBlElement ifAbsent: anAbsentBlock [
 
 	^ self
@@ -51,7 +49,7 @@ AlbTextEditorLineSegmentPieceMap >> pieceForElement: aBlElement ifAbsent: anAbse
 		  ifAbsent: anAbsentBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> pieceForElement: aBlElement ifPresent: aBlock ifAbsent: anAbsentBlock [
 
 	map keysAndValuesDo: [ :k :v |
@@ -60,7 +58,7 @@ AlbTextEditorLineSegmentPieceMap >> pieceForElement: aBlElement ifPresent: aBloc
 	^ anAbsentBlock value
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentPieceMap >> piecesAndTheirElementsDo: aBlock [
 
 	map keysAndValuesDo: [ :aPiece :thePieceElements |
diff --git a/src/Album/AlbTextEditorLineSegmentSplitter.class.st b/src/Album/AlbTextEditorLineSegmentSplitter.class.st
index f9218fe..8f6068f 100644
--- a/src/Album/AlbTextEditorLineSegmentSplitter.class.st
+++ b/src/Album/AlbTextEditorLineSegmentSplitter.class.st
@@ -1,28 +1,26 @@
 Class {
-	#name : 'AlbTextEditorLineSegmentSplitter',
-	#superclass : 'Object',
+	#name : #AlbTextEditorLineSegmentSplitter,
+	#superclass : #Object,
 	#instVars : [
 		'characterClassifier',
 		'privateCount'
 	],
-	#category : 'Album-Model-Segment',
-	#package : 'Album',
-	#tag : 'Model-Segment'
+	#category : 'Album-Model-Segment'
 }
 
-{ #category : 'splitting configuration' }
+{ #category : #'splitting configuration' }
 AlbTextEditorLineSegmentSplitter >> beCharacterBased [
 
 	characterClassifier := self characterBasedClassifier
 ]
 
-{ #category : 'splitting configuration' }
+{ #category : #'splitting configuration' }
 AlbTextEditorLineSegmentSplitter >> beSeparatorBased [
 
 	characterClassifier := self separatorBasedClassifier
 ]
 
-{ #category : 'splitting configuration' }
+{ #category : #'splitting configuration' }
 AlbTextEditorLineSegmentSplitter >> characterBasedClassifier [
 
 	"Return a block that compute a type of an item within a segment.
@@ -35,13 +33,13 @@ AlbTextEditorLineSegmentSplitter >> characterBasedClassifier [
 	^ [ :obj | self privateCount ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentSplitter >> characterClassifier [
 
 	^ characterClassifier
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentSplitter >> characterClassifier: aValuable [
 
 
@@ -53,7 +51,7 @@ AlbTextEditorLineSegmentSplitter >> characterClassifier: aValuable [
 	characterClassifier := aValuable
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegmentSplitter >> defaultCharacterClassifier [
 
 	"Return a block that compute a type of an item within a segment.
@@ -63,7 +61,7 @@ AlbTextEditorLineSegmentSplitter >> defaultCharacterClassifier [
 	^ self separatorBasedClassifier
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorLineSegmentSplitter >> initialize [
 
 	super initialize.
@@ -72,7 +70,7 @@ AlbTextEditorLineSegmentSplitter >> initialize [
 
 ]
 
-{ #category : 'private - pieces computation' }
+{ #category : #'private - pieces computation' }
 AlbTextEditorLineSegmentSplitter >> itemValueType: anObject [
 
 	"Return a type of an item within a segment.
@@ -82,13 +80,13 @@ AlbTextEditorLineSegmentSplitter >> itemValueType: anObject [
 	^ self characterClassifier value: anObject
 ]
 
-{ #category : 'private - pieces computation' }
+{ #category : #'private - pieces computation' }
 AlbTextEditorLineSegmentSplitter >> privateCount [
 
 	^  privateCount := privateCount + 1
 ]
 
-{ #category : 'private - pieces computation' }
+{ #category : #'private - pieces computation' }
 AlbTextEditorLineSegmentSplitter >> processPureWords: aTextIterator in: aStream offset: anOffset [
 
 	"Process a text within a scope of the given iterator as if it does not contain any adornment attributes
@@ -106,7 +104,7 @@ AlbTextEditorLineSegmentSplitter >> processPureWords: aTextIterator in: aStream
 		aStream nextPut: (self textPiece: aWord from: aTextStart to: aTextEnd) ]
 ]
 
-{ #category : 'private - pieces computation' }
+{ #category : #'private - pieces computation' }
 AlbTextEditorLineSegmentSplitter >> processSegment: aTextIterator in: aStream offset: anOffset [		
 	"Process a text within the scope of the given iterator.
 	We can split text into pieces based on the presence of event handling attributes. 
@@ -123,7 +121,7 @@ AlbTextEditorLineSegmentSplitter >> processSegment: aTextIterator in: aStream of
 				self processPureWords: aSpanIterator in: aStream offset: anOffset + aDelta ] ]
 ]
 
-{ #category : 'splitting configuration' }
+{ #category : #'splitting configuration' }
 AlbTextEditorLineSegmentSplitter >> separatorBasedClassifier [
 
 	"Return a block that compute a type of an item within a segment.
@@ -138,7 +136,7 @@ AlbTextEditorLineSegmentSplitter >> separatorBasedClassifier [
 		  ifFalse: [ #object ] ]
 ]
 
-{ #category : 'splitting' }
+{ #category : #splitting }
 AlbTextEditorLineSegmentSplitter >> split: aText from: aStartIndex to: anEndIndex [
 
 	"aStartIndex and anEndIndex are given in cursor coordinates"
@@ -151,7 +149,7 @@ AlbTextEditorLineSegmentSplitter >> split: aText from: aStartIndex to: anEndInde
 			  stream nextPut: (self textPiece: (aText from: 1 to: aText size) from: aStartIndex to: anEndIndex) ] ]
 ]
 
-{ #category : 'splitting' }
+{ #category : #splitting }
 AlbTextEditorLineSegmentSplitter >> splitSegment: aTextEditorSegment [
 
 	| thePieces |
@@ -163,7 +161,7 @@ AlbTextEditorLineSegmentSplitter >> splitSegment: aTextEditorSegment [
 	^ thePieces
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorLineSegmentSplitter >> textPiece: aBlSubText from: aTextStart to: aTextEnd [
 	"Create and return a text segment piece"
 	<return: #AlbTextEditorAbstractSegmentPiece>
@@ -175,7 +173,7 @@ AlbTextEditorLineSegmentSplitter >> textPiece: aBlSubText from: aTextStart to: a
 		delimiter: 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentSplitter >> textPieceClass [
 	"Create and return a text segment piece"
 
diff --git a/src/Album/AlbTextEditorLineSegmentTextListener.class.st b/src/Album/AlbTextEditorLineSegmentTextListener.class.st
index 93487c6..3ab1a5e 100644
--- a/src/Album/AlbTextEditorLineSegmentTextListener.class.st
+++ b/src/Album/AlbTextEditorLineSegmentTextListener.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextEditorLineSegmentTextListener',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextEditorLineSegmentTextListener,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorLineSegmentTextListener >> eventClass [
 	^ BlMouseEvent
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextEditorLineSegmentTextListener >> handleEvent: aBlMouseEvent [
 
 	| aTextElement anEditorElement aLocalPosition aTextIndex anIterator theAttributes textEditor |
diff --git a/src/Album/AlbTextEditorLineSegmentTextPiece.class.st b/src/Album/AlbTextEditorLineSegmentTextPiece.class.st
index efd8ba7..8bf9046 100644
--- a/src/Album/AlbTextEditorLineSegmentTextPiece.class.st
+++ b/src/Album/AlbTextEditorLineSegmentTextPiece.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorLineSegmentTextPiece',
-	#superclass : 'AlbTextEditorAbstractSegmentPiece',
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#name : #AlbTextEditorLineSegmentTextPiece,
+	#superclass : #AlbTextEditorAbstractSegmentPiece,
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorLineSegmentTextPiece >> = anotherObject [
 	self == anotherObject
 		ifTrue: [ ^ true ].
@@ -16,7 +14,7 @@ AlbTextEditorLineSegmentTextPiece >> = anotherObject [
 	^ anotherObject text = self text
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorLineSegmentTextPiece >> createElement: anEditorElement [
 	<return: #BlElement>
 	| anElement |
@@ -29,12 +27,12 @@ AlbTextEditorLineSegmentTextPiece >> createElement: anEditorElement [
 	^ anElement
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorLineSegmentTextPiece >> hash [
 	^ self class hash bitXor: self text hash
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorLineSegmentTextPiece >> isText [
 	^ true
 ]
diff --git a/src/Album/AlbTextEditorLineSplitter.class.st b/src/Album/AlbTextEditorLineSplitter.class.st
index 2977f53..8e4d999 100644
--- a/src/Album/AlbTextEditorLineSplitter.class.st
+++ b/src/Album/AlbTextEditorLineSplitter.class.st
@@ -2,19 +2,17 @@
 I split a piece of text into line segments `BrTextEditorLineSegment`
 "
 Class {
-	#name : 'AlbTextEditorLineSplitter',
-	#superclass : 'AlbTextEditorSplitter',
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#name : #AlbTextEditorLineSplitter,
+	#superclass : #AlbTextEditorSplitter,
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorLineSplitter >> newSegment [
 	^ AlbTextEditorLineSegment new
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorLineSplitter >> newSegment: aBlText from: aStartIndex to: anEndIndex delimited: aDelimiterIndex offset: anOffset [
 	| aSubText anAbsoluteTextStart anAbsoluteTextEnd |
 	"aStartIndex and anEndIndex are given in text coordinates"
@@ -33,7 +31,7 @@ AlbTextEditorLineSplitter >> newSegment: aBlText from: aStartIndex to: anEndInde
 		delimiter: aDelimiterIndex - anEndIndex
 ]
 
-{ #category : 'api - splitting' }
+{ #category : #'api - splitting' }
 AlbTextEditorLineSplitter >> split: aText in: aEditorSegmentStream offset: anOffset [
 
 	| anIterator |
diff --git a/src/Album/AlbTextEditorMemento.class.st b/src/Album/AlbTextEditorMemento.class.st
index 617cd75..067ad1b 100644
--- a/src/Album/AlbTextEditorMemento.class.st
+++ b/src/Album/AlbTextEditorMemento.class.st
@@ -1,42 +1,40 @@
 Class {
-	#name : 'AlbTextEditorMemento',
-	#superclass : 'Object',
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#name : #AlbTextEditorMemento,
+	#superclass : #Object,
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorMemento >> isSelectionMemento [
 	^ false
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorMemento >> isTextMemento [
 	^ false
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorMemento >> label [
 	^ self subclassResponsibility
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorMemento >> order [
 	^ self subclassResponsibility
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorMemento >> restoreStateOf: aTextEditor [
 	self subclassResponsibility
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorMemento >> saveStateOf: aTextEditor [
 	self subclassResponsibility
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorMemento >> value [
 	^ self subclassResponsibility
 ]
diff --git a/src/Album/AlbTextEditorMouseHandler.class.st b/src/Album/AlbTextEditorMouseHandler.class.st
index 4a07458..ee17274 100644
--- a/src/Album/AlbTextEditorMouseHandler.class.st
+++ b/src/Album/AlbTextEditorMouseHandler.class.st
@@ -1,18 +1,16 @@
 Class {
-	#name : 'AlbTextEditorMouseHandler',
-	#superclass : 'AlbEditorElementHandler',
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#name : #AlbTextEditorMouseHandler,
+	#superclass : #AlbEditorElementHandler,
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorMouseHandler >> eventsToHandle [
 
 	^ { BlMouseDownEvent }
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorMouseHandler >> mouseDownEvent: anEvent [
 
 	| aNavigator aScreenPosition editor aTextIndex |
diff --git a/src/Album/AlbTextEditorMultipleCursor.class.st b/src/Album/AlbTextEditorMultipleCursor.class.st
index a95e4c2..7c4859b 100644
--- a/src/Album/AlbTextEditorMultipleCursor.class.st
+++ b/src/Album/AlbTextEditorMultipleCursor.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorMultipleCursor',
-	#superclass : 'AlbTextEditorCursor',
+	#name : #AlbTextEditorMultipleCursor,
+	#superclass : #AlbTextEditorCursor,
 	#instVars : [
 		'cursors'
 	],
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorMultipleCursor >> = anotherObject [
 	self == anotherObject
 		ifTrue: [ ^ true ].
@@ -19,48 +17,48 @@ AlbTextEditorMultipleCursor >> = anotherObject [
 	^ anotherObject cursors = self cursors
 ]
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbTextEditorMultipleCursor >> add: aSingleCursor [
 	self cursors add: aSingleCursor
 ]
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbTextEditorMultipleCursor >> addAll: aCollectionOfSingleCursor [
 	self cursors addAll: aCollectionOfSingleCursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorMultipleCursor >> cursors [
 	<return: #Collection of: #AlbTextEditorCursor>
 
 	^ cursors
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorMultipleCursor >> do: aBlock [
 	"Evaluate a given block with all available cursors"
 
 	^ self cursors do: aBlock
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorMultipleCursor >> hash [
 	^ self class hash bitXor: self cursors hash
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorMultipleCursor >> initialize [
 	super initialize.
 
 	cursors := OrderedCollection new
 ]
 
-{ #category : 'copying' }
+{ #category : #copying }
 AlbTextEditorMultipleCursor >> postCopy [
 	cursors := cursors collect: [ :cursor | cursor copy ]
 ]
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbTextEditorMultipleCursor >> remove: aSingleCursor [
 	self cursors remove: aSingleCursor
 ]
diff --git a/src/Album/AlbTextEditorNavigator.class.st b/src/Album/AlbTextEditorNavigator.class.st
index bbd2aa3..93fd97c 100644
--- a/src/Album/AlbTextEditorNavigator.class.st
+++ b/src/Album/AlbTextEditorNavigator.class.st
@@ -6,8 +6,8 @@ I am responsible for cursor navigation.
 - and finally perform cursor movement operations
 "
 Class {
-	#name : 'AlbTextEditorNavigator',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorNavigator,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'shouldResetDesiredCoordinate',
 		'operations',
@@ -15,12 +15,10 @@ Class {
 		'shouldHistorize',
 		'nextTextPosition'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> addAt: aTextPosition [
 	"Add a cursor at a given text position"
 	self privateAssertPosition: aTextPosition.
@@ -28,14 +26,14 @@ AlbTextEditorNavigator >> addAt: aTextPosition [
 	self moveTo: aTextPosition
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> addAtScreenPosition: aScreenPosition [
 	"Add a cursor at a given screen position"
 
 	self moveToScreenPosition: aScreenPosition 
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorNavigator >> apply [
 	| prevTextPosition |
 	
@@ -51,17 +49,17 @@ AlbTextEditorNavigator >> apply [
 	dueTo := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigator >> dueTo [
 	^ dueTo
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigator >> dueTo: aTextEditorOperator [
 	dueTo := aTextEditorOperator
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorNavigator >> initialize [
 	super initialize.
 	operations := OrderedCollection new.
@@ -70,35 +68,35 @@ AlbTextEditorNavigator >> initialize [
 
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> move: aCursor by: aDelta [
 	"Move a given cursor by a provided delta"
 
 	operations add: ((AlbTextEditorNavigatorMoveByOperation cursor: aCursor) delta: aDelta)
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> move: aCursor to: aTextPosition [
 	"Move a given cursor to a provided position"
 	self privateAssertPosition: aTextPosition.
 	operations add: ((AlbTextEditorNavigatorMoveToOperation cursor: aCursor) position: aTextPosition)
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveBy: aDelta [
 	"Move all cursors by a given delta. The operation is only applied on existing cursor, not the ones that will be added"
 
 	self cursor do: [ :aCursor | operations add: ((AlbTextEditorNavigatorMoveByOperation cursor: aCursor) delta: aDelta) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveDown [
 	"Move all cursors down one line"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveDownOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveLeft [
 
 	| delta |
@@ -107,7 +105,7 @@ AlbTextEditorNavigator >> moveLeft [
 	operations add: ((AlbTextEditorNavigatorMoveByOperation cursor: self cursor) delta: delta)
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveRight [
 	"Move all cursors one to the right"
 	| delta |
@@ -116,7 +114,7 @@ AlbTextEditorNavigator >> moveRight [
 	operations add: ((AlbTextEditorNavigatorMoveByOperation cursor: self cursor) delta: delta)
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveTo: aTextPosition [
 	"Move all cursors to a given position (basically, remove all cursors except one)"
 	self privateAssertPosition: aTextPosition.
@@ -125,48 +123,48 @@ AlbTextEditorNavigator >> moveTo: aTextPosition [
 
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveToEndNextWord [
 	"Move all cursors to the end of the next word"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveToEndNextWordOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveToLineEnd [
 	"Move all cursors to the end of their corresponding lines"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveToLineEndOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveToLineStart [
 	"Move all cursors to the start of their corresponding lines"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveToLineStartOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveToScreenPosition: aScreenPosition [
 	"Move all cursors to a given screen position (basically, remove all cursors except one)"
 	operations add: ((AlbTextEditorNavigatorMoveAtScreenPositionOperation cursor: self cursor) screenPosition: aScreenPosition).
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveToStartPreviousWord [
 	"Move all cursors to the start of the previous word"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveToStartPreviousWordOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveUp [
 	"Move all cursors up one line"
 
 	self cursor do: [ :aCursor | operations add: (AlbTextEditorNavigatorMoveUpOperation cursor: aCursor) ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> moveWithin: anInterval [
 	"Move all cursors so that they end up within a given text interval.
 	The operation is only applied on existing cursor, not the ones that will be added"
@@ -178,14 +176,14 @@ AlbTextEditorNavigator >> moveWithin: anInterval [
 				ifTrue: [ self move: aCursor to: anInterval last ] ] ]
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorNavigator >> privateAssertPosition: aTextPosition [
 	self
 		assert: [ aTextPosition between: 0 and: self text size ]
 		description: [ 'Cursor position ({1}) must be within the interval [0.. {2}]' format: { aTextPosition . self text size } ].
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorNavigator >> privateMoveCursor: aCursor to: aTextIndex [
 
 	| prevIndex nextIndex |
@@ -209,48 +207,48 @@ AlbTextEditorNavigator >> privateMoveCursor: aCursor to: aTextIndex [
 			 dueTo: (dueTo ifNil: [ self ]))
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorNavigator >> privateNormalizePosition: aTextPosition [
 	^ (aTextPosition max: 0) min: self text size
 ]
 
-{ #category : 'private - registration' }
+{ #category : #'private - registration' }
 AlbTextEditorNavigator >> privateRegisterForMove: aCursor by: aDelta [
 	nextTextPosition := self cursor position + aDelta
 ]
 
-{ #category : 'private - registration' }
+{ #category : #'private - registration' }
 AlbTextEditorNavigator >> privateRegisterForMove: aCursor to: aTextPosition [
 	nextTextPosition := aTextPosition
 ]
 
-{ #category : 'api - events' }
+{ #category : #'api - events' }
 AlbTextEditorNavigator >> whenMoved: aBlock [
 	"Subscribe to the cursor moved event and return an event handler"
 
 	^ self when: AlbCursorMovedEvent do: aBlock
 ]
 
-{ #category : 'api - events' }
+{ #category : #'api - events' }
 AlbTextEditorNavigator >> whenReachedBoundary: aBlock [
 	"Subscribe to the cursor reached boundary event and return an event handler"
 
 	^ self when: AlbCursorReachedBoundaryEvent do: aBlock
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> withHistorization [
 	"Add cursor movement to the history sos that it can be undone / redone"
 	
 	shouldHistorize := true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> withResettingDesiredCoordinate [
 	shouldResetDesiredCoordinate := true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorNavigator >> withoutResettingDesiredCoordinate [
 	shouldResetDesiredCoordinate := false
 ]
diff --git a/src/Album/AlbTextEditorNavigatorMoveAtScreenPositionOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveAtScreenPositionOperation.class.st
index f37b12a..0347f3b 100644
--- a/src/Album/AlbTextEditorNavigatorMoveAtScreenPositionOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveAtScreenPositionOperation.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveAtScreenPositionOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
+	#name : #AlbTextEditorNavigatorMoveAtScreenPositionOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
 	#instVars : [
 		'screenPosition'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveAtScreenPositionOperation >> performOn: aNavigator [
 	| aGlobalTextIndex |
 	
@@ -22,12 +20,12 @@ AlbTextEditorNavigatorMoveAtScreenPositionOperation >> performOn: aNavigator [
 		to: aGlobalTextIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveAtScreenPositionOperation >> screenPosition [
 	^ screenPosition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveAtScreenPositionOperation >> screenPosition: anObject [
 	screenPosition := anObject
 ]
diff --git a/src/Album/AlbTextEditorNavigatorMoveByOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveByOperation.class.st
index 9d55556..16fb0b2 100644
--- a/src/Album/AlbTextEditorNavigatorMoveByOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveByOperation.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveByOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
+	#name : #AlbTextEditorNavigatorMoveByOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
 	#instVars : [
 		'delta'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveByOperation >> delta [
 	^ delta
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveByOperation >> delta: anObject [
 	delta := anObject
 ]
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveByOperation >> performOn: aNavigator [
 	aNavigator privateRegisterForMove: self cursor by: self delta
 ]
diff --git a/src/Album/AlbTextEditorNavigatorMoveDownOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveDownOperation.class.st
index 47c9192..71e260d 100644
--- a/src/Album/AlbTextEditorNavigatorMoveDownOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveDownOperation.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveDownOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveDownOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveDownOperation >> performOn: aNavigator [
 	| aGlobalTextIndex |
 	
diff --git a/src/Album/AlbTextEditorNavigatorMoveToEndNextWordOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveToEndNextWordOperation.class.st
index cdc67d9..37961db 100644
--- a/src/Album/AlbTextEditorNavigatorMoveToEndNextWordOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveToEndNextWordOperation.class.st
@@ -2,14 +2,12 @@
 I move a cursor to the end of the current word when in the middle of a word, or to the end of the next word, when at the end of the current word
 "
 Class {
-	#name : 'AlbTextEditorNavigatorMoveToEndNextWordOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveToEndNextWordOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveToEndNextWordOperation >> performOn: aNavigator [
 	
 	aNavigator
diff --git a/src/Album/AlbTextEditorNavigatorMoveToLineEndOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveToLineEndOperation.class.st
index c25c9b9..faa9582 100644
--- a/src/Album/AlbTextEditorNavigatorMoveToLineEndOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveToLineEndOperation.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveToLineEndOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveToLineEndOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveToLineEndOperation >> performOn: aNavigator [
 	| aText aTextIterator foundLineBreak |
 	
diff --git a/src/Album/AlbTextEditorNavigatorMoveToLineStartOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveToLineStartOperation.class.st
index f8b18da..de20b32 100644
--- a/src/Album/AlbTextEditorNavigatorMoveToLineStartOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveToLineStartOperation.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveToLineStartOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveToLineStartOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveToLineStartOperation >> performOn: aNavigator [
 	| aDelta |	
 
diff --git a/src/Album/AlbTextEditorNavigatorMoveToOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveToOperation.class.st
index 59c7c73..7757092 100644
--- a/src/Album/AlbTextEditorNavigatorMoveToOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveToOperation.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveToOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
+	#name : #AlbTextEditorNavigatorMoveToOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
 	#instVars : [
 		'position'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveToOperation >> performOn: aNavigator [
 	aNavigator privateRegisterForMove: self cursor to: self position 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveToOperation >> position [
 	^ position
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorMoveToOperation >> position: anObject [
 	position := anObject
 ]
diff --git a/src/Album/AlbTextEditorNavigatorMoveToStartPreviousWordOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveToStartPreviousWordOperation.class.st
index e30201f..7a30e49 100644
--- a/src/Album/AlbTextEditorNavigatorMoveToStartPreviousWordOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveToStartPreviousWordOperation.class.st
@@ -2,14 +2,12 @@
 I move a cursor to the beginning of the current word when in the middle of a word, or to the beginning of the previous word, when at the beginning of the current word
 "
 Class {
-	#name : 'AlbTextEditorNavigatorMoveToStartPreviousWordOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveToStartPreviousWordOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveToStartPreviousWordOperation >> performOn: aNavigator [
 	"Moves cursor to the left until the start of the previous word"
 	
diff --git a/src/Album/AlbTextEditorNavigatorMoveUpOperation.class.st b/src/Album/AlbTextEditorNavigatorMoveUpOperation.class.st
index 2c96e9d..ed03dfb 100644
--- a/src/Album/AlbTextEditorNavigatorMoveUpOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorMoveUpOperation.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNavigatorMoveUpOperation',
-	#superclass : 'AlbTextEditorNavigatorOperation',
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#name : #AlbTextEditorNavigatorMoveUpOperation,
+	#superclass : #AlbTextEditorNavigatorOperation,
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorMoveUpOperation >> performOn: aNavigator [
 	| aGlobalTextIndex |
 	
diff --git a/src/Album/AlbTextEditorNavigatorOperation.class.st b/src/Album/AlbTextEditorNavigatorOperation.class.st
index 6bdad75..edf837b 100644
--- a/src/Album/AlbTextEditorNavigatorOperation.class.st
+++ b/src/Album/AlbTextEditorNavigatorOperation.class.st
@@ -1,30 +1,28 @@
 Class {
-	#name : 'AlbTextEditorNavigatorOperation',
-	#superclass : 'Object',
+	#name : #AlbTextEditorNavigatorOperation,
+	#superclass : #Object,
 	#instVars : [
 		'cursor'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorNavigatorOperation class >> cursor: aCursor [
 	^ self new cursor: aCursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorOperation >> cursor [
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNavigatorOperation >> cursor: anObject [
 	cursor := anObject
 ]
 
-{ #category : 'matching' }
+{ #category : #matching }
 AlbTextEditorNavigatorOperation >> performOn: aNavigator [
 	self subclassResponsibility
 ]
diff --git a/src/Album/AlbTextEditorNoInputFilter.class.st b/src/Album/AlbTextEditorNoInputFilter.class.st
index 6856fec..24dedaf 100644
--- a/src/Album/AlbTextEditorNoInputFilter.class.st
+++ b/src/Album/AlbTextEditorNoInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNoInputFilter',
-	#superclass : 'AlbTextEditorInputFilter',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorNoInputFilter,
+	#superclass : #AlbTextEditorInputFilter,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNoInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorNoLineBreakInputFilter.class.st b/src/Album/AlbTextEditorNoLineBreakInputFilter.class.st
index 92e84cf..d83c5e7 100644
--- a/src/Album/AlbTextEditorNoLineBreakInputFilter.class.st
+++ b/src/Album/AlbTextEditorNoLineBreakInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNoLineBreakInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorNoLineBreakInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNoLineBreakInputFilter >> filter: aString [
 
 	<return: #String>
diff --git a/src/Album/AlbTextEditorNoSpaceInputFilter.class.st b/src/Album/AlbTextEditorNoSpaceInputFilter.class.st
index 78e4bbe..637eae9 100644
--- a/src/Album/AlbTextEditorNoSpaceInputFilter.class.st
+++ b/src/Album/AlbTextEditorNoSpaceInputFilter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorNoSpaceInputFilter',
-	#superclass : 'AlbTextEditorInputFilterDecorator',
-	#category : 'Album-Model-Input-filters',
-	#package : 'Album',
-	#tag : 'Model-Input-filters'
+	#name : #AlbTextEditorNoSpaceInputFilter,
+	#superclass : #AlbTextEditorInputFilterDecorator,
+	#category : 'Album-Model-Input-filters'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorNoSpaceInputFilter >> filter: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextEditorOperator.class.st b/src/Album/AlbTextEditorOperator.class.st
index 3293f66..f27bdaa 100644
--- a/src/Album/AlbTextEditorOperator.class.st
+++ b/src/Album/AlbTextEditorOperator.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextEditorOperator',
-	#superclass : 'Object',
+	#name : #AlbTextEditorOperator,
+	#superclass : #Object,
 	#instVars : [
 		'editor',
 		'subscriptions',
 		'context'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorOperator >> apply [
 	^ self subclassResponsibility 
 ]
 
-{ #category : 'private - asserting' }
+{ #category : #'private - asserting' }
 AlbTextEditorOperator >> assertUIProcess [
 	editor assertUIProcess
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> characterType: aCharacter [
 	<return: #Symbol>
 
@@ -34,45 +32,45 @@ AlbTextEditorOperator >> characterType: aCharacter [
 	^ #other
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> context [
 	^ context
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> context: anObject [
 	"An object that understands #telemetry message"
 	context := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> cursor [
 	^ editor cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> cursor: aCursor [
 	editor cursor: aCursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> cursors [
 
 	^  { self cursor } asSet
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> editor [
 	^ editor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> editor: aTextEditor [
 
 	editor := aTextEditor
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findLineEndAfter: aTextIndex [
 	<return: #Number>
 	| aText aTextIterator foundLineBreak |
@@ -90,7 +88,7 @@ AlbTextEditorOperator >> findLineEndAfter: aTextIndex [
 	^ aTextIterator position - foundLineBreak asBit
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findLineStartBefore: aTextIndex [
 	"Please note, I return 0 for the first line"
 	<return: #Number>
@@ -115,7 +113,7 @@ AlbTextEditorOperator >> findLineStartBefore: aTextIndex [
 	^ aTextIterator position + foundLineBreak asBit
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findLineStartsBetween: aTextStart and: aTextEnd [
 	<return: #Number>
 	| aText aTextIterator |
@@ -129,7 +127,7 @@ AlbTextEditorOperator >> findLineStartsBetween: aTextStart and: aTextEnd [
 				ifTrue: [ aStream nextPut: aTextIterator position ] ] ]
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAboveCursor: aCursor ifAbsent: anExceptionBlock [
 	"Find a text index one line above the given cursor"
 	<return: #Number>
@@ -149,7 +147,7 @@ AlbTextEditorOperator >> findTextIndexAboveCursor: aCursor ifAbsent: anException
 		ifNil: anExceptionBlock
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAtCursor: aCursor ifAbsent: anExceptionBlock [
 	"Find a text index one line below the given cursor"
 	<return: #Number>
@@ -175,7 +173,7 @@ AlbTextEditorOperator >> findTextIndexAtCursor: aCursor ifAbsent: anExceptionBlo
 	^ aGlobalTextIndex
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAtLineEnd: aCursor [
 	"Find a text index at the end of the line where the cursor is located"
 	<return: #Number>
@@ -194,7 +192,7 @@ AlbTextEditorOperator >> findTextIndexAtLineEnd: aCursor [
 	^ aTextIterator position - foundLineBreak asBit
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAtLineStart: aCursor [
 	"Find a text index at the start of the line where the cursor is located"
 	<return: #Number>
@@ -216,7 +214,7 @@ AlbTextEditorOperator >> findTextIndexAtLineStart: aCursor [
 	^ aTextIterator position + foundLineBreak asBit
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAtScreenPosition: aScreenPosition [
 	"Convert screen position to a text index"
 	<return: #Number>
@@ -237,7 +235,7 @@ AlbTextEditorOperator >> findTextIndexAtScreenPosition: aScreenPosition [
 	^ aGlobalTextIndex
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexAtScreenPosition: aScreenPosition ifAbsent: anExceptionBlock [
 	"Convert screen position to a text index"
 	<return: #Number>
@@ -262,7 +260,7 @@ AlbTextEditorOperator >> findTextIndexAtScreenPosition: aScreenPosition ifAbsent
 	^ aGlobalTextIndex
 ]
 
-{ #category : 'api - utility' }
+{ #category : #'api - utility' }
 AlbTextEditorOperator >> findTextIndexBelowCursor: aCursor ifAbsent: anExceptionBlock [
 	"Find a text index one line below the given cursor"
 	<return: #Number>
@@ -289,7 +287,7 @@ AlbTextEditorOperator >> findTextIndexBelowCursor: aCursor ifAbsent: anException
 	^ aGlobalTextIndex
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findWhitespaceOfLineBefore: aTextIndex [
 
 	<return: #String>
@@ -311,7 +309,7 @@ AlbTextEditorOperator >> findWhitespaceOfLineBefore: aTextIndex [
 	^ sp
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findWordAt: aTextIndex [
 	"Find a word text interval or a whitespace at a given text index"
 	<return: #Interval>
@@ -345,7 +343,7 @@ AlbTextEditorOperator >> findWordAt: aTextIndex [
 	^ aWordStart to: aWordEnd
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findWordEndAfter: aTextIndex [
 	"Find a text index of the end of the next word after a given text index"
 	| textIterator newPosition aText |
@@ -363,7 +361,7 @@ AlbTextEditorOperator >> findWordEndAfter: aTextIndex [
 	^ newPosition
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> findWordStartBefore: aTextIndex [
 	"Find a text index of start of the previous word before a given text index"
 	| newPosition aText |
@@ -379,7 +377,7 @@ AlbTextEditorOperator >> findWordStartBefore: aTextIndex [
 	^ newPosition
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> hasSpaceAroundCursor: aCursor [
 	"Answer a boolean indicating whether the characters either side of the cursor are separators (or end of string)"
 	| anIterator |
@@ -395,13 +393,13 @@ AlbTextEditorOperator >> hasSpaceAroundCursor: aCursor [
 	^ true
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorOperator >> hasSpaceAroundIndex: anIndex [
 
 	^ self hasSpaceAroundCursor: (AlbTextEditorSingleCursor at: anIndex)
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> hasString: aString afterCursor: aCursor [
 	| anIterator |
 	
@@ -422,7 +420,7 @@ AlbTextEditorOperator >> hasString: aString afterCursor: aCursor [
 	^ true
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> hasString: aString beforeCursor: aCursor [
 	| anIterator |
 	
@@ -444,45 +442,45 @@ AlbTextEditorOperator >> hasString: aString beforeCursor: aCursor [
 	^ true
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorOperator >> initialize [
 	super initialize.
 
 	subscriptions := OrderedCollection new
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorOperator >> isCursorOnTheFirstLine: aCursor [
 	<return: #Boolean>
 
 	^ (self findLineStartBefore: (aCursor position max: self text isNotEmpty asBit)) isZero
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorOperator >> isCursorOnTheLastLine: aCursor [
 	<return: #Boolean>
 
 	^ (self findLineEndAfter: (aCursor position + 1 max: self text isNotEmpty asBit)) = self text size
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorOperator >> isDeleter [
 	^ false
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorOperator >> isInserter [
 	^ false
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorOperator >> isWordChar: aCharacter [
 	<return: #Number>
 
 	^ aCharacter isAlphaNumeric
 ]
 
-{ #category : 'notifying' }
+{ #category : #notifying }
 AlbTextEditorOperator >> notifyCursorAdded: aCursor [
 	| aCommand |
 
@@ -492,12 +490,12 @@ AlbTextEditorOperator >> notifyCursorAdded: aCursor [
 	editor executeCommand: aCommand
 ]
 
-{ #category : 'notifying' }
+{ #category : #notifying }
 AlbTextEditorOperator >> notifyCursorRemoved [
 	self notifyCursorRemoved: self cursor
 ]
 
-{ #category : 'notifying' }
+{ #category : #notifying }
 AlbTextEditorOperator >> notifyCursorRemoved: aCursor [
 	| aCommand |
 
@@ -507,12 +505,12 @@ AlbTextEditorOperator >> notifyCursorRemoved: aCursor [
 	editor executeCommand: aCommand
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> selection [
 	^ editor selection
 ]
 
-{ #category : 'api - event' }
+{ #category : #'api - event' }
 AlbTextEditorOperator >> subscribe: anEventHandler [
 
 	editor addEventHandler: anEventHandler.
@@ -520,19 +518,19 @@ AlbTextEditorOperator >> subscribe: anEventHandler [
 	^ anEventHandler
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorOperator >> text [
 
 	^ editor privateText
 ]
 
-{ #category : 'api - event' }
+{ #category : #'api - event' }
 AlbTextEditorOperator >> unsubscribe [
 
 	subscriptions do: [ :anEventHandler | editor removeEventHandler: anEventHandler ]
 ]
 
-{ #category : 'api - event' }
+{ #category : #'api - event' }
 AlbTextEditorOperator >> when: anEventClass do: aBlock [
 
 	^ self subscribe: (BlEventHandler on: anEventClass do: aBlock)
diff --git a/src/Album/AlbTextEditorPaster.class.st b/src/Album/AlbTextEditorPaster.class.st
index 43d7e03..d3b1949 100644
--- a/src/Album/AlbTextEditorPaster.class.st
+++ b/src/Album/AlbTextEditorPaster.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbTextEditorPaster',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorPaster,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'text',
 		'insertionIndices',
@@ -9,17 +9,15 @@ Class {
 		'shouldDeleteSelected',
 		'inputFilter'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorPaster >> apply [
 	^ self paste
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> at: anIndex [
 	"Add a given index as another text paste location"
 
@@ -27,23 +25,23 @@ AlbTextEditorPaster >> at: anIndex [
 		ifFalse: [ insertionIndices add: anIndex ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> atCursor [	
 	self cursor do: [ :aCursor | self at: aCursor position ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> atEnd [
 	"Insert a text at the very end"
 	self at: self text size
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> fromClipboard [
 	self string: Clipboard clipboardText asString
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorPaster >> initialize [
 	super initialize.
 	
@@ -55,12 +53,12 @@ AlbTextEditorPaster >> initialize [
 	inputFilter := AlbTextEditorNoInputFilter new
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> inputFilter: aTextEditorInputFilter [
 	inputFilter := aTextEditorInputFilter
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorPaster >> paste [
 	| anInserter |
 	
@@ -75,27 +73,27 @@ AlbTextEditorPaster >> paste [
 	anInserter insert
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> string: aString [
 	text := aString
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> text: aText [
 	text := aText
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> withoutCursorUpdate [
 	shouldUpdateCursor := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> withoutSelectionDelete [
 	shouldDeleteSelected := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorPaster >> withoutSelectionUpdate [
 	shouldUpdateSelection := false
 ]
diff --git a/src/Album/AlbTextEditorRecordDeselectionSignal.class.st b/src/Album/AlbTextEditorRecordDeselectionSignal.class.st
index bfcf168..01cb3df 100644
--- a/src/Album/AlbTextEditorRecordDeselectionSignal.class.st
+++ b/src/Album/AlbTextEditorRecordDeselectionSignal.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextEditorRecordDeselectionSignal',
-	#superclass : 'Announcement',
+	#name : #AlbTextEditorRecordDeselectionSignal,
+	#superclass : #Announcement,
 	#instVars : [
 		'selection'
 	],
-	#category : 'Album-Model-Selection',
-	#package : 'Album',
-	#tag : 'Model-Selection'
+	#category : 'Album-Model-Selection'
 }
 
-{ #category : 'printing' }
+{ #category : #printing }
 AlbTextEditorRecordDeselectionSignal >> printOneLineContentsOn: stream [
 	self selection printOn: stream 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRecordDeselectionSignal >> selection [
 	^ selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRecordDeselectionSignal >> selection: anObject [
 	selection := anObject
 ]
diff --git a/src/Album/AlbTextEditorRecordSelectionSignal.class.st b/src/Album/AlbTextEditorRecordSelectionSignal.class.st
index debd559..26b5c65 100644
--- a/src/Album/AlbTextEditorRecordSelectionSignal.class.st
+++ b/src/Album/AlbTextEditorRecordSelectionSignal.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextEditorRecordSelectionSignal',
-	#superclass : 'Announcement',
+	#name : #AlbTextEditorRecordSelectionSignal,
+	#superclass : #Announcement,
 	#instVars : [
 		'selection'
 	],
-	#category : 'Album-Model-Selection',
-	#package : 'Album',
-	#tag : 'Model-Selection'
+	#category : 'Album-Model-Selection'
 }
 
-{ #category : 'printing' }
+{ #category : #printing }
 AlbTextEditorRecordSelectionSignal >> printOneLineContentsOn: stream [
 	self selection printOn: stream 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRecordSelectionSignal >> selection [
 	^ selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRecordSelectionSignal >> selection: anObject [
 	selection := anObject
 ]
diff --git a/src/Album/AlbTextEditorRelativeScreenToCursorTransformation.class.st b/src/Album/AlbTextEditorRelativeScreenToCursorTransformation.class.st
index 970a660..124ca66 100644
--- a/src/Album/AlbTextEditorRelativeScreenToCursorTransformation.class.st
+++ b/src/Album/AlbTextEditorRelativeScreenToCursorTransformation.class.st
@@ -1,61 +1,59 @@
 Class {
-	#name : 'AlbTextEditorRelativeScreenToCursorTransformation',
-	#superclass : 'AlbTextEditorScreenToCursorTransformation',
+	#name : #AlbTextEditorRelativeScreenToCursorTransformation,
+	#superclass : #AlbTextEditorScreenToCursorTransformation,
 	#instVars : [
 		'cursor',
 		'direction'
 	],
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> beDown [
 	self direction: #down
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> beUp [
 	self direction: #up
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> cursor [
 	^ cursor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> cursor: anObject [
 	cursor := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> direction [
 	^ direction
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRelativeScreenToCursorTransformation >> direction: aSymbol [
 	direction := aSymbol
 ]
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorRelativeScreenToCursorTransformation >> evaluateOn: anObject [
 	anObject relativeScreenToCursor: self
 ]
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorRelativeScreenToCursorTransformation >> evaluateOn: anObject for: anEvent [
 	anObject relativeScreenToCursor: self for: anEvent
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorRelativeScreenToCursorTransformation >> isDown [
 	^ self direction = #down
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorRelativeScreenToCursorTransformation >> isUp [
 	^ self direction = #up
 ]
diff --git a/src/Album/AlbTextEditorReplacedEvent.class.st b/src/Album/AlbTextEditorReplacedEvent.class.st
index 6d3807d..7e9e846 100644
--- a/src/Album/AlbTextEditorReplacedEvent.class.st
+++ b/src/Album/AlbTextEditorReplacedEvent.class.st
@@ -1,34 +1,32 @@
 Class {
-	#name : 'AlbTextEditorReplacedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextEditorReplacedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'previous',
 		'current'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorReplacedEvent >> current [
 
 	^ current
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorReplacedEvent >> current: aTextEditor [
 
 	current := aTextEditor
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorReplacedEvent >> previous [
 
 	^ previous
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorReplacedEvent >> previous: aTextEditor [
 
 	previous := aTextEditor
diff --git a/src/Album/AlbTextEditorRequest.class.st b/src/Album/AlbTextEditorRequest.class.st
index c541e3f..398eb65 100644
--- a/src/Album/AlbTextEditorRequest.class.st
+++ b/src/Album/AlbTextEditorRequest.class.st
@@ -1,20 +1,18 @@
 Class {
-	#name : 'AlbTextEditorRequest',
-	#superclass : 'BlEvent',
+	#name : #AlbTextEditorRequest,
+	#superclass : #BlEvent,
 	#instVars : [
 		'editorElement'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRequest >> editorElement [
 	^ editorElement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorRequest >> editorElement: anObject [
 	editorElement := anObject
 ]
diff --git a/src/Album/AlbTextEditorScreenToCursorCommand.class.st b/src/Album/AlbTextEditorScreenToCursorCommand.class.st
index f52794b..0d69dbc 100644
--- a/src/Album/AlbTextEditorScreenToCursorCommand.class.st
+++ b/src/Album/AlbTextEditorScreenToCursorCommand.class.st
@@ -1,21 +1,19 @@
 Class {
-	#name : 'AlbTextEditorScreenToCursorCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorScreenToCursorCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'transformation'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorScreenToCursorCommand >> executeOn: aTextEditor [
 
 	self transformation evaluateOn: self for: aTextEditor
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorScreenToCursorCommand >> explicitScreenToCursor: aTransformation for: aTextEditor [
 
 	"we convert a pure screen position, should send to all visible segment holders"
@@ -23,13 +21,13 @@ AlbTextEditorScreenToCursorCommand >> explicitScreenToCursor: aTransformation fo
 
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorScreenToCursorCommand >> newHolderEvent [
 	^ AlbTextEditorScreenToCursorHolderEvent new
 		transformation: self transformation
 ]
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorScreenToCursorCommand >> relativeScreenToCursor: aTransformation for: aTextEditor [
 
 	"we convert a relative screen position, should send only to the segment at the cursor position"
@@ -41,12 +39,12 @@ AlbTextEditorScreenToCursorCommand >> relativeScreenToCursor: aTransformation fo
 		ifNotFound: [  ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorCommand >> transformation [
 	^ transformation
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorCommand >> transformation: anObject [
 	transformation := anObject
 ]
diff --git a/src/Album/AlbTextEditorScreenToCursorHolderEvent.class.st b/src/Album/AlbTextEditorScreenToCursorHolderEvent.class.st
index 3ae7955..b01ea69 100644
--- a/src/Album/AlbTextEditorScreenToCursorHolderEvent.class.st
+++ b/src/Album/AlbTextEditorScreenToCursorHolderEvent.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextEditorScreenToCursorHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
+	#name : #AlbTextEditorScreenToCursorHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
 	#instVars : [
 		'transformation'
 	],
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorScreenToCursorHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder screenToCursor: self transformation
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorHolderEvent >> transformation [
 	^ transformation
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorHolderEvent >> transformation: anObject [
 	transformation := anObject
 ]
diff --git a/src/Album/AlbTextEditorScreenToCursorRequest.class.st b/src/Album/AlbTextEditorScreenToCursorRequest.class.st
index 97b62b5..81d50af 100644
--- a/src/Album/AlbTextEditorScreenToCursorRequest.class.st
+++ b/src/Album/AlbTextEditorScreenToCursorRequest.class.st
@@ -1,20 +1,18 @@
 Class {
-	#name : 'AlbTextEditorScreenToCursorRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorScreenToCursorRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'transformation'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorRequest >> transformation [
 	^ transformation
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorRequest >> transformation: anObject [
 	transformation := anObject
 ]
diff --git a/src/Album/AlbTextEditorScreenToCursorTransformation.class.st b/src/Album/AlbTextEditorScreenToCursorTransformation.class.st
index aac7c9a..7436563 100644
--- a/src/Album/AlbTextEditorScreenToCursorTransformation.class.st
+++ b/src/Album/AlbTextEditorScreenToCursorTransformation.class.st
@@ -1,37 +1,35 @@
 Class {
-	#name : 'AlbTextEditorScreenToCursorTransformation',
-	#superclass : 'Object',
+	#name : #AlbTextEditorScreenToCursorTransformation,
+	#superclass : #Object,
 	#instVars : [
 		'resultBlock',
 		'resultIndex'
 	],
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorScreenToCursorTransformation >> evaluateOn: anObject [
 	self subclassResponsibility
 ]
 
-{ #category : 'dispatching' }
+{ #category : #dispatching }
 AlbTextEditorScreenToCursorTransformation >> evaluateOn: anObject for: anEvent [
 	self subclassResponsibility
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorScreenToCursorTransformation >> hasResult [
 	^ resultIndex isNotNil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorTransformation >> transformed: aTextIndex [
 	resultIndex := aTextIndex.
 	resultBlock value: aTextIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorScreenToCursorTransformation >> whenTransformed: aBlock [
 	resultBlock := aBlock
 ]
diff --git a/src/Album/AlbTextEditorSegment.class.st b/src/Album/AlbTextEditorSegment.class.st
index 9097e5b..d5d67c3 100644
--- a/src/Album/AlbTextEditorSegment.class.st
+++ b/src/Album/AlbTextEditorSegment.class.st
@@ -5,24 +5,22 @@ We split the whole text into segment in order to support infinite list that is u
 By default segment is a single line: a piece of text between new line characters
 "
 Class {
-	#name : 'AlbTextEditorSegment',
-	#superclass : 'Object',
+	#name : #AlbTextEditorSegment,
+	#superclass : #Object,
 	#traits : 'TAlbTextEditorTextualPiece + TBlDebug',
 	#classTraits : 'TAlbTextEditorTextualPiece classTrait + TBlDebug classTrait',
 	#instVars : [
 		'index'
 	],
-	#category : 'Album-Model-Segment-Text',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text'
+	#category : 'Album-Model-Segment-Text'
 }
 
-{ #category : 'pieces - computation' }
+{ #category : #'pieces - computation' }
 AlbTextEditorSegment >> clearCache [
 	"Clear all caches and make this segment fresh as if it would just be created and initalized"
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegment >> index [
 	"Return segment index within Editor.
 	Note: index can not be nil"
@@ -35,12 +33,12 @@ AlbTextEditorSegment >> index [
 	^ index
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegment >> index: aNumber [
 	index := aNumber
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegment >> initializeWith: aBlSubText from: aTextStart to: aTextEnd delimiter: aDelimiterLength [
 	self
 		assert: [ aBlSubText isKindOf: BlSubText ]
@@ -56,7 +54,7 @@ AlbTextEditorSegment >> initializeWith: aBlSubText from: aTextStart to: aTextEnd
 	self updateSegmentProperties
 ]
 
-{ #category : 'api - operations' }
+{ #category : #'api - operations' }
 AlbTextEditorSegment >> insert: aCollectionOfSegments [
 	| theSegments theRestLength |
 	<return: #Collection of: #AblTextEditorSegment>
@@ -80,7 +78,7 @@ AlbTextEditorSegment >> insert: aCollectionOfSegments [
 	^ theSegments
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegment >> isAllLineBreak [
 	"Return true if segment only consists of line break, false otherwise"
 	<return: #Boolean>
@@ -88,21 +86,21 @@ AlbTextEditorSegment >> isAllLineBreak [
 	^ self text allSatisfy: #isLineBreak
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegment >> isFirstIn: aTextEditor [
 	"Return true if I am absolutely the very first segment (not first cached) in a given text editor"
 
 	^ self index = 1
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegment >> isLastIn: aTextEditor [
 	"Return true if I am absolutely the very last segment (not last cached) in a given text editor"
 
 	^ self index = aTextEditor segmentCollector segments size
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegment >> isLineBreak [
 	"Return true if segment only consists of line break, false otherwise"
 	<return: #Boolean>
@@ -110,7 +108,7 @@ AlbTextEditorSegment >> isLineBreak [
 	^ self text anySatisfy: #isLineBreak
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegment >> moveTextBy: aNumber [
 	"Move all sub-text pieces (#start and #end) known by the segment by a given amount of indicies.
 	If aNumber is negative sub-texts will be moved to the left (maybe this is a result of a deletion).
@@ -120,10 +118,10 @@ AlbTextEditorSegment >> moveTextBy: aNumber [
 	self start: textStart + aNumber end: textEnd + aNumber
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegment >> moveTextPiecesBy: aNumber at: aTextIndex [
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegment >> updateSegmentProperties [
 ]
diff --git a/src/Album/AlbTextEditorSegmentCollector.class.st b/src/Album/AlbTextEditorSegmentCollector.class.st
index bff3640..2150323 100644
--- a/src/Album/AlbTextEditorSegmentCollector.class.st
+++ b/src/Album/AlbTextEditorSegmentCollector.class.st
@@ -21,8 +21,8 @@ To facilitate jumping backwards quickly the the manager builds a map of line num
 The limit represents the maximum number of items held by the receiver when an uncached segment is requested (`BrTextEditorSegmentCollector>>#segmentAt:}`).  If segments are added via `BrTextEditorSegmentCollector>>#addSegments:after:}` or `BrTextEditorSegmentCollector>>#addSegments:before:}` the limit may be safely exceeded.
 "
 Class {
-	#name : 'AlbTextEditorSegmentCollector',
-	#superclass : 'Object',
+	#name : #AlbTextEditorSegmentCollector,
+	#superclass : #Object,
 	#traits : 'TBlDebug',
 	#classTraits : 'TBlDebug classTrait',
 	#instVars : [
@@ -33,12 +33,10 @@ Class {
 		'cacheLimit',
 		'lineSplitter'
 	],
-	#category : 'Album-Model-Segment-Text',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text'
+	#category : 'Album-Model-Segment-Text'
 }
 
-{ #category : 'cache - adding / removing' }
+{ #category : #'cache - adding / removing' }
 AlbTextEditorSegmentCollector >> addSegments: aCollectionOfSegments after: aSegment in: aTextEditor [
 	"Add the supplied collection of segments to the receiver after aSegment.
 	This may safely cause the number of cached segments to exceed limit."
@@ -55,7 +53,7 @@ AlbTextEditorSegmentCollector >> addSegments: aCollectionOfSegments after: aSegm
 	aTextEditor notifyItemsInserted: (aCollectionOfSegments first index to: aCollectionOfSegments last index).
 ]
 
-{ #category : 'cache - adding / removing' }
+{ #category : #'cache - adding / removing' }
 AlbTextEditorSegmentCollector >> addSegments: aCollectionOfSegments before: aSegment in: aTextEditor [
 	"Add the supplied collection of segments to the receiver before aSegment.
 	This may safely cause the number of cached segments to exceed limit."
@@ -79,7 +77,7 @@ AlbTextEditorSegmentCollector >> addSegments: aCollectionOfSegments before: aSeg
 
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> addedAttribute: anAttribute from: aFromIndex to: aToIndex in: aTextEditor [
 
 	"Is sent after an attribute was added in provided text editor"
@@ -102,7 +100,7 @@ AlbTextEditorSegmentCollector >> addedAttribute: anAttribute from: aFromIndex to
 		update
 ]
 
-{ #category : 'cache - adding / removing' }
+{ #category : #'cache - adding / removing' }
 AlbTextEditorSegmentCollector >> assertSegmentIndicesMustCorrespondToTheInterval [
 	self
 		assert: [ self segments size = segmentsInterval size ]
@@ -121,12 +119,12 @@ AlbTextEditorSegmentCollector >> assertSegmentIndicesMustCorrespondToTheInterval
 	
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> cacheLimit [
 	^ cacheLimit
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> cacheLimit: anInteger [
 	cacheLimit = anInteger ifTrue: [ ^self ].
 	self resetCache.
@@ -134,12 +132,12 @@ AlbTextEditorSegmentCollector >> cacheLimit: anInteger [
 	self computeForwardAt: 1
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> cacheSize: anInteger [
 	self cacheLimit: anInteger
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> cachedAt: anIndex [
 	"Return a cached segment at an absolute index within editor
 	(I must convert index from editor coordinates to my local cache coordinates)"
@@ -150,7 +148,7 @@ AlbTextEditorSegmentCollector >> cachedAt: anIndex [
 	^ self segments at: aCachedIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> cachedInterval [
 	"Return the interval of the indices of the currently cached segments"
 	<return: #Number>
@@ -158,7 +156,7 @@ AlbTextEditorSegmentCollector >> cachedInterval [
 	^ segmentsInterval
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> cachedSegmentAt: aTextIndex ifFound: aFoundBlock ifNotFound: aNotFoundBlock [
 	| segmentIndex segment |
 
@@ -182,7 +180,7 @@ AlbTextEditorSegmentCollector >> cachedSegmentAt: aTextIndex ifFound: aFoundBloc
 	aFoundBlock cull: segment
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> cachedSegmentIndexAt: aTextIndex [
 	"Return an index of a segment in a collection of cached segments that contains
 	a text item with a given index or return 0 if no such *cached* segment exists.
@@ -217,7 +215,7 @@ AlbTextEditorSegmentCollector >> cachedSegmentIndexAt: aTextIndex [
 						ifFalse: [ 0 ] ] ]
 ]
 
-{ #category : 'cache - adding / removing' }
+{ #category : #'cache - adding / removing' }
 AlbTextEditorSegmentCollector >> computeForwardAt: anIndex [
 
 	| stream newSegments idx currSize seg |
@@ -246,7 +244,7 @@ AlbTextEditorSegmentCollector >> computeForwardAt: anIndex [
 	self computeSubText
 ]
 
-{ #category : 'private - computing' }
+{ #category : #'private - computing' }
 AlbTextEditorSegmentCollector >> computeSegmentAt: anIndex [
 
 	<return: #AlbTextEditorSegment>
@@ -261,7 +259,7 @@ AlbTextEditorSegmentCollector >> computeSegmentAt: anIndex [
 	^ self cachedAt: anIndex
 ]
 
-{ #category : 'private - computing' }
+{ #category : #'private - computing' }
 AlbTextEditorSegmentCollector >> computeSubText [
 	"Recompute subtext according to currently cached segments"
 	| subTextStart subTextEnd |
@@ -282,7 +280,7 @@ AlbTextEditorSegmentCollector >> computeSubText [
 	"self assert: subText asString lines size <= segments size."
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> computedSegmentsCount [
 	"Return amount of cached segments. If segments are not cached,
 	try to cache them and return their amount"
@@ -294,20 +292,20 @@ AlbTextEditorSegmentCollector >> computedSegmentsCount [
 	^ self lastIndex
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegmentCollector >> defaultCacheLimit [
 
 	"Arbitrary value "
 	^ 50
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegmentCollector >> defaultSplitter [
 
 	^ AlbTextEditorLineSplitter new
 ]
 
-{ #category : 'private - deletion' }
+{ #category : #'private - deletion' }
 AlbTextEditorSegmentCollector >> deleteFrom: aFromIndex segment: aFromSegment to: aToIndex segment: aToSegment in: aTextEditor [
 	"I do the hard work of updating segment structure after deleting a piece of text within provided interval and segments"
 	| shouldMergeWithPrevious aTargetSegment removedLength aNewEnd aNewStart |
@@ -350,7 +348,7 @@ AlbTextEditorSegmentCollector >> deleteFrom: aFromIndex segment: aFromSegment to
 	^ aTargetSegment
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> deletedFrom: aFromIndex to: aToIndex in: aTextEditor [
 	| aFromSegment aToSegment aTargetSegment |
 
@@ -384,7 +382,7 @@ AlbTextEditorSegmentCollector >> deletedFrom: aFromIndex to: aToIndex in: aTextE
 		update
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> end [
 	"Return the index of the last cached item in the text or 0 if nothing is cached"
 	<return: #Number>
@@ -394,7 +392,7 @@ AlbTextEditorSegmentCollector >> end [
 		ifFalse: [ 0 ]
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> firstIndex [
 	"Return the index of the first cached segment or 0 if there are no cached segments"
 	<return: #Number>
@@ -404,7 +402,7 @@ AlbTextEditorSegmentCollector >> firstIndex [
 		ifFalse: [ 0 ]
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegmentCollector >> hasCached [
 	"Return true if there are cached segments, false otherwise"
 	<return: #Boolean>
@@ -412,7 +410,7 @@ AlbTextEditorSegmentCollector >> hasCached [
 	^ segments isNotEmpty
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegmentCollector >> initialize [
 
 	super initialize.
@@ -423,7 +421,7 @@ AlbTextEditorSegmentCollector >> initialize [
 	self resetCache
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> insertedString: aString at: aTextIndex in: aTextEditor [
 
 	"I am doing a hard work updating editor's segment cache due to inserted string.
@@ -451,7 +449,7 @@ AlbTextEditorSegmentCollector >> insertedString: aString at: aTextIndex in: aTex
 		update
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSegmentCollector >> isCachedAt: anIndex [
 	"Return true if I have a cached segment at a given index, false otherwise"
 	<return: #Boolean>
@@ -459,7 +457,7 @@ AlbTextEditorSegmentCollector >> isCachedAt: anIndex [
 	^ segmentsInterval rangeIncludes: anIndex
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> lastIndex [
 	"Return the index of the last cached segment or 0 if there are no cached segments"
 	<return: #Number>
@@ -469,7 +467,7 @@ AlbTextEditorSegmentCollector >> lastIndex [
 		ifFalse: [ 0 ]
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> moveTextBy: aNumber [
 	"move all segments' subTexts start/end indices by aNumber"
 
@@ -480,7 +478,7 @@ AlbTextEditorSegmentCollector >> moveTextBy: aNumber [
 	self computeSubText
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> moveTextBy: aNumber after: aSegment [
 	"move all segments after the given segment by aNumber"
 
@@ -492,12 +490,12 @@ AlbTextEditorSegmentCollector >> moveTextBy: aNumber after: aSegment [
 	self computeSubText
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollector >> newSegmentStream [
 	^ AlbEditorSegmentStream new
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollector >> newSegments [
 
 	"Return a new empty collection that will be used to store segments"
@@ -506,7 +504,7 @@ AlbTextEditorSegmentCollector >> newSegments [
 	^ OrderedCollection new
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> offsetSegmentIndicesBy: anOffset [
 	"Offset segments' #index by anOffset of all cached segments"
 	
@@ -515,7 +513,7 @@ AlbTextEditorSegmentCollector >> offsetSegmentIndicesBy: anOffset [
 		after: self firstIndex - 1
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> offsetSegmentIndicesBy: anOffset after: aSegmentIndex [
 	"Offset segments' #index by anOffset of all segments after a given segment index.
 	Note: #lastIndex is not valid during execution of this method!"
@@ -534,7 +532,7 @@ AlbTextEditorSegmentCollector >> offsetSegmentIndicesBy: anOffset after: aSegmen
 	segmentsInterval := segmentsInterval first to: segmentsInterval last + anOffset
 ]
 
-{ #category : 'cache - adding / removing' }
+{ #category : #'cache - adding / removing' }
 AlbTextEditorSegmentCollector >> removeSegmentInterval: anInterval in: aTextEditor [
 	"Remove all segments within index interval"
 
@@ -547,7 +545,7 @@ AlbTextEditorSegmentCollector >> removeSegmentInterval: anInterval in: aTextEdit
 	aTextEditor notifyItemsRemoved: anInterval
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 AlbTextEditorSegmentCollector >> removedAttributesFrom: aFromIndex to: aToIndex in: aTextEditor [
 
 	"Is sent after an attributes were removed in provided text editor"
@@ -570,7 +568,7 @@ AlbTextEditorSegmentCollector >> removedAttributesFrom: aFromIndex to: aToIndex
 		update
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegmentCollector >> resetCache [
 
 	segmentsInterval := 0 to: 0.
@@ -578,7 +576,7 @@ AlbTextEditorSegmentCollector >> resetCache [
 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> segmentAt: anIndex [
 	"Return segment at given index"
 	<return: #AlbTextEditorSegment>
@@ -588,14 +586,14 @@ AlbTextEditorSegmentCollector >> segmentAt: anIndex [
 		ifFalse: [ self computeSegmentAt: anIndex ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> segments [
 	<return: #SequenceableCollection of: #AlbTextEditorSegment>
 
 	^ segments
 ]
 
-{ #category : 'private - deletion' }
+{ #category : #'private - deletion' }
 AlbTextEditorSegmentCollector >> shouldMergeDeletingFrom: aFromIndex segment: aFromSegment in: aTextEditor [
 
 	"Return true if we should merge a given segment with the previous if we delete a piece of
@@ -617,19 +615,19 @@ AlbTextEditorSegmentCollector >> shouldMergeDeletingFrom: aFromIndex segment: aF
 	^ aFromIndex - aPreviousSegment textEnd = 1
 ]
 
-{ #category : 'api - splitting' }
+{ #category : #'api - splitting' }
 AlbTextEditorSegmentCollector >> split: aText in: anEditorSegmentStream [
 
 	lineSplitter split: aText in: anEditorSegmentStream
 ]
 
-{ #category : 'api - splitting' }
+{ #category : #'api - splitting' }
 AlbTextEditorSegmentCollector >> split: aText in: anEditorSegmentStream offset: anOffset [
 
 	lineSplitter split: aText in: anEditorSegmentStream offset: anOffset
 ]
 
-{ #category : 'cache - accessing' }
+{ #category : #'cache - accessing' }
 AlbTextEditorSegmentCollector >> start [
 	"Return the index of the first cached item in the text or 0 if nothing is cached"
 	<return: #Number>
@@ -639,25 +637,25 @@ AlbTextEditorSegmentCollector >> start [
 		ifFalse: [ 0 ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> subText [
 	^ subText 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> text [
 	<return: #BlText>
 
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSegmentCollector >> text: aText [
 	text := aText.
 	self computeForwardAt: 1
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollector >> validateIntegrity: aTextEditor [
 
 	| anIntegrity |
@@ -669,7 +667,7 @@ AlbTextEditorSegmentCollector >> validateIntegrity: aTextEditor [
 	self assert: [ anIntegrity key ] description: [ anIntegrity value key ]
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollector >> validateSegmentsIn: aTextEditor [
 
 	"Validate integrity of the segments.
@@ -734,7 +732,7 @@ AlbTextEditorSegmentCollector >> validateSegmentsIn: aTextEditor [
 	^ true -> 'ok'
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSegmentCollector >> validateTextPieceUniquenessIn: aTextEditor [
 
 	| allTextPieces allGroupedTextPieces |
diff --git a/src/Album/AlbTextEditorSegmentElement.class.st b/src/Album/AlbTextEditorSegmentElement.class.st
index 7abe1d1..8d99916 100644
--- a/src/Album/AlbTextEditorSegmentElement.class.st
+++ b/src/Album/AlbTextEditorSegmentElement.class.st
@@ -6,20 +6,18 @@ Users may customize me by changing segment's layout, margin, padding or visual p
 Override me for more advanced customizations
 "
 Class {
-	#name : 'AlbTextEditorSegmentElement',
-	#superclass : 'BlElement',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbTextEditorSegmentElement,
+	#superclass : #BlElement,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSegmentElement >> initialize [ 
 	super initialize.
 	self clipChildren: false
 ]
 
-{ #category : 'api - compositing' }
+{ #category : #'api - compositing' }
 AlbTextEditorSegmentElement >> wantsSeparateCompositingLayer [
 
 	^ false
diff --git a/src/Album/AlbTextEditorSelectCommand.class.st b/src/Album/AlbTextEditorSelectCommand.class.st
index 3d7fdb4..6542392 100644
--- a/src/Album/AlbTextEditorSelectCommand.class.st
+++ b/src/Album/AlbTextEditorSelectCommand.class.st
@@ -3,18 +3,16 @@ I select an interval of text from ===fromIndex=== to ===toIndex===.
 I do not remove existing selections, I just add new one on top merging overlapping intervals
 "
 Class {
-	#name : 'AlbTextEditorSelectCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorSelectCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorSelectCommand >> executeOn: aTextEditor [
 
 	self fromIndex = self toIndex
@@ -25,22 +23,22 @@ AlbTextEditorSelectCommand >> executeOn: aTextEditor [
 	aTextEditor notifySelectionChanged: aTextEditor selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectCommand >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectCommand >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectCommand >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditorSelectRequest.class.st b/src/Album/AlbTextEditorSelectRequest.class.st
index d5fca63..0cc4638 100644
--- a/src/Album/AlbTextEditorSelectRequest.class.st
+++ b/src/Album/AlbTextEditorSelectRequest.class.st
@@ -1,31 +1,29 @@
 Class {
-	#name : 'AlbTextEditorSelectRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorSelectRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectRequest >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectRequest >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectRequest >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectRequest >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditorSelecter.class.st b/src/Album/AlbTextEditorSelecter.class.st
index 7a4c60c..0abf901 100644
--- a/src/Album/AlbTextEditorSelecter.class.st
+++ b/src/Album/AlbTextEditorSelecter.class.st
@@ -2,20 +2,18 @@
 When in ""cursor update mode"" I place cursors at the end of each selection
 "
 Class {
-	#name : 'AlbTextEditorSelecter',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorSelecter,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'selection',
 		'shouldUpdateCursor',
 		'shouldDeselectExisting',
 		'commands'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> all [
 	"Select the whole text"
 	
@@ -24,18 +22,18 @@ AlbTextEditorSelecter >> all [
 		to: self text size
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> all: aCompositeSelection [
 	aCompositeSelection do: [ :eachMonotoneSelection |
 		self from: eachMonotoneSelection from to: eachMonotoneSelection to ]
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorSelecter >> apply [
 	^ self select
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToIndex: anIndex [
 	| cursorPosition |
 	cursorPosition := self cursor position.
@@ -44,7 +42,7 @@ AlbTextEditorSelecter >> extendToIndex: anIndex [
 		ifFalse: [ self from: anIndex to: cursorPosition ]
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToLineEnd [
 	"Extend selection to the end of the line"
 	|  cmd globalCursor delta |
@@ -58,7 +56,7 @@ AlbTextEditorSelecter >> extendToLineEnd [
 	commands add: cmd
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToLineStart [
 
 	"Extend selection to the start of the line"
@@ -75,7 +73,7 @@ AlbTextEditorSelecter >> extendToLineStart [
 	commands add: cmd
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToNextWordEnd [
 	"Extend selection to the end of the next word"
 	|  theCommands |
@@ -93,7 +91,7 @@ AlbTextEditorSelecter >> extendToNextWordEnd [
 	commands addAll: theCommands
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToPreviousWordStart [
 	"Extend selection to start of the previous word"
 	|  theCommands |
@@ -111,7 +109,7 @@ AlbTextEditorSelecter >> extendToPreviousWordStart [
 	commands addAll: theCommands
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> extendToWholeLine [
 
 	"Extend selection to the line"
@@ -121,7 +119,7 @@ AlbTextEditorSelecter >> extendToWholeLine [
 		extendToLineEnd
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> findExistingSelectionEndAfter: aTextIndex within: aTextInterval [
 	| anEndIndex |
 	
@@ -137,7 +135,7 @@ AlbTextEditorSelecter >> findExistingSelectionEndAfter: aTextIndex within: aText
 	^ anEndIndex
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> findExistingSelectionStartBefore: aTextIndex within: aTextInterval [
 	| aStartIndex |
 	
@@ -153,7 +151,7 @@ AlbTextEditorSelecter >> findExistingSelectionStartBefore: aTextIndex within: aT
 	^ aStartIndex
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> from: aFromIndex to: aToIndex [
 
 	commands add: (AlbExtendSelectionCommand new 
@@ -162,7 +160,7 @@ AlbTextEditorSelecter >> from: aFromIndex to: aToIndex [
 		toAddCursor: aToIndex)
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSelecter >> initialize [
 	super initialize.
 
@@ -172,7 +170,7 @@ AlbTextEditorSelecter >> initialize [
 	commands := OrderedCollection new
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> moveOneDown [
 	"Select and move a cursor one line down"
 	| theCommands theNewCursorPositions theCursorsOnTheLeft theCursorsOnTheRight theCursorsOutside |
@@ -216,7 +214,7 @@ AlbTextEditorSelecter >> moveOneDown [
 	commands addAll: theCommands.
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> moveOneToLeft [
 	"Select and move a cursor one character to the left"
 	|  theCommands |
@@ -231,7 +229,7 @@ AlbTextEditorSelecter >> moveOneToLeft [
 	commands addAll: theCommands
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> moveOneToRight [
 	"Select and move a cursor one character to the right"
 	|  theCommands |
@@ -246,7 +244,7 @@ AlbTextEditorSelecter >> moveOneToRight [
 	commands addAll: theCommands
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> moveOneUp [
 	"Select and move a cursor one line up"
 	| theNewCursorPositions theCursorsOnTheLeft theCursorsOnTheRight theCursorsOutside theCommands |
@@ -291,14 +289,14 @@ AlbTextEditorSelecter >> moveOneUp [
 	commands addAll: theCommands.
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> overwrite [
 	"Deselect any selections if they exist and overwrite with the new selection"
 	
 	shouldDeselectExisting := true
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privateDeselectExisting: aSelection [
 	| aDeselecter |
 	
@@ -310,7 +308,7 @@ AlbTextEditorSelecter >> privateDeselectExisting: aSelection [
 	aDeselecter deselect
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privateExtendSelectionLeftAt: aTextPosition by: anAmount [
 	| hasSelectionAfter toSelect toDeselect aNewSelectionStart |
 
@@ -361,7 +359,7 @@ AlbTextEditorSelecter >> privateExtendSelectionLeftAt: aTextPosition by: anAmoun
 		toDeselect: toDeselect
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privateExtendSelectionRightAt: aTextPosition by: anAmount [
 	| hasSelectionBefore toSelect toDeselect aNewSelectionEnd |
 
@@ -412,7 +410,7 @@ AlbTextEditorSelecter >> privateExtendSelectionRightAt: aTextPosition by: anAmou
 		toDeselect: toDeselect
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privateFrom: aFromIndex to: aToIndex [
 
 	aFromIndex = aToIndex
@@ -421,7 +419,7 @@ AlbTextEditorSelecter >> privateFrom: aFromIndex to: aToIndex [
 	selection select: aFromIndex to: aToIndex
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privatePerformSelectAndDeselectCommands: theCommands [
 	| aDeselecter  |
 
@@ -461,7 +459,7 @@ AlbTextEditorSelecter >> privatePerformSelectAndDeselectCommands: theCommands [
 		aNavigator apply ].
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> privateSelect: aFromTextIndex to: aToTextIndex [
 	"Select text within an interval defined by provided from and to indices without any other side effects.
 	Note:
@@ -486,7 +484,7 @@ AlbTextEditorSelecter >> privateSelect: aFromTextIndex to: aToTextIndex [
 	editor executeCommand: aCommand
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorSelecter >> select [
 
 	| toBeSelected |
@@ -511,7 +509,7 @@ AlbTextEditorSelecter >> select [
 	" do not send updateCursors to self here otherwise, navigator moveUp is broken " 
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextEditorSelecter >> updateCursors [
 	| aNavigator |
 	
@@ -521,12 +519,12 @@ AlbTextEditorSelecter >> updateCursors [
 	aNavigator apply
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> withoutCursorUpdate [
 	shouldUpdateCursor := false
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorSelecter >> wordAt: aTextIndex [
 	"Select a word or a whitespace at a given text index"
 	| aWordInterval |
diff --git a/src/Album/AlbTextEditorSelectionChangedHolderEvent.class.st b/src/Album/AlbTextEditorSelectionChangedHolderEvent.class.st
index 2639a14..c8d4c14 100644
--- a/src/Album/AlbTextEditorSelectionChangedHolderEvent.class.st
+++ b/src/Album/AlbTextEditorSelectionChangedHolderEvent.class.st
@@ -2,14 +2,12 @@
 I trigger a selection update in the text piece
 "
 Class {
-	#name : 'AlbTextEditorSelectionChangedHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#name : #AlbTextEditorSelectionChangedHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorSelectionChangedHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder onSelectionChanged
 ]
diff --git a/src/Album/AlbTextEditorSelectionHandler.class.st b/src/Album/AlbTextEditorSelectionHandler.class.st
index 8782606..02ef5dc 100644
--- a/src/Album/AlbTextEditorSelectionHandler.class.st
+++ b/src/Album/AlbTextEditorSelectionHandler.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorSelectionHandler',
-	#superclass : 'AlbEditorElementHandler',
+	#name : #AlbTextEditorSelectionHandler,
+	#superclass : #AlbEditorElementHandler,
 	#instVars : [
 		'startIndex'
 	],
-	#category : 'Album-UI-Handlers',
-	#package : 'Album',
-	#tag : 'UI-Handlers'
+	#category : 'Album-UI-Handlers'
 }
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorSelectionHandler >> dragEndEvent: anEvent [
 
 	anEvent consumed: true.
@@ -17,7 +15,7 @@ AlbTextEditorSelectionHandler >> dragEndEvent: anEvent [
 
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorSelectionHandler >> dragEvent: anEvent [
 
 	| anEditor currentIndex from to |
@@ -38,7 +36,7 @@ AlbTextEditorSelectionHandler >> dragEvent: anEvent [
 	element selectionChanged
 ]
 
-{ #category : 'event handling' }
+{ #category : #'event handling' }
 AlbTextEditorSelectionHandler >> dragStartEvent: anEvent [
 	| anEditor |	
 	anEvent consumed: true.
@@ -52,7 +50,7 @@ AlbTextEditorSelectionHandler >> dragStartEvent: anEvent [
 	element selectionChanged
 ]
 
-{ #category : 'api - accessing' }
+{ #category : #'api - accessing' }
 AlbTextEditorSelectionHandler >> eventsToHandle [
 	^ { BlDragEvent . BlDragStartEvent. BlDragEndEvent}
 ]
diff --git a/src/Album/AlbTextEditorSelectionMemento.class.st b/src/Album/AlbTextEditorSelectionMemento.class.st
index bcc1b5a..96c4163 100644
--- a/src/Album/AlbTextEditorSelectionMemento.class.st
+++ b/src/Album/AlbTextEditorSelectionMemento.class.st
@@ -1,37 +1,35 @@
 Class {
-	#name : 'AlbTextEditorSelectionMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorSelectionMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'selection'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSelectionMemento >> initialize [
 	super initialize.
 	
 	selection := BlCompositeSelection new
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSelectionMemento >> isSelectionMemento [
 	^ true
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorSelectionMemento >> label [
 	^ 'Selection'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionMemento >> order [
 	^ 70
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorSelectionMemento >> restoreStateOf: aTextEditor [
 	aTextEditor deselecter all deselect.
 
@@ -41,22 +39,22 @@ AlbTextEditorSelectionMemento >> restoreStateOf: aTextEditor [
 		select
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorSelectionMemento >> saveStateOf: aTextEditor [
 	selection := aTextEditor selection copy.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionMemento >> selection [
 	^ selection
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionMemento >> selection: anObject [
 	selection := anObject
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorSelectionMemento >> value [
 	^ selection
 ]
diff --git a/src/Album/AlbTextEditorSelectionOverwriteRecorder.class.st b/src/Album/AlbTextEditorSelectionOverwriteRecorder.class.st
index 3ec7ae1..78be4ec 100644
--- a/src/Album/AlbTextEditorSelectionOverwriteRecorder.class.st
+++ b/src/Album/AlbTextEditorSelectionOverwriteRecorder.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorSelectionOverwriteRecorder',
-	#superclass : 'AlbTextEditorSelectionRecorder',
+	#name : #AlbTextEditorSelectionOverwriteRecorder,
+	#superclass : #AlbTextEditorSelectionRecorder,
 	#instVars : [
 		'compositeSelection'
 	],
-	#category : 'Album-Model-Selection',
-	#package : 'Album',
-	#tag : 'Model-Selection'
+	#category : 'Album-Model-Selection'
 }
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionOverwriteRecorder >> commit: aTextEditor [
 	"Commit recorded selection intervals in a given text editor"
 	
@@ -22,7 +20,7 @@ AlbTextEditorSelectionOverwriteRecorder >> commit: aTextEditor [
 	compositeSelection := BlCompositeSelection new
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionOverwriteRecorder >> deselect: aMonotoneTextSelection in: aTextEditor [
 
 	(AlbTextEditorRecordDeselectionSignal new selection: aMonotoneTextSelection) emit.
@@ -31,14 +29,14 @@ AlbTextEditorSelectionOverwriteRecorder >> deselect: aMonotoneTextSelection in:
 	aTextEditor updateSelection: aMonotoneTextSelection from to: aMonotoneTextSelection to
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSelectionOverwriteRecorder >> initialize [
 	super initialize.
 	
 	compositeSelection := BlCompositeSelection new
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionOverwriteRecorder >> prepare: aTextEditor [
 	
 	compositeSelection := BlCompositeSelection new.
@@ -46,7 +44,7 @@ AlbTextEditorSelectionOverwriteRecorder >> prepare: aTextEditor [
 	aTextEditor selectNone
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionOverwriteRecorder >> select: aMonotoneTextSelection in: aTextEditor [
 	"Add a given selection to the list of recorded selections"
 	
@@ -56,7 +54,7 @@ AlbTextEditorSelectionOverwriteRecorder >> select: aMonotoneTextSelection in: aT
 	aTextEditor updateSelection: aMonotoneTextSelection from to: aMonotoneTextSelection to
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionOverwriteRecorder >> selection [
 	<return: #BlSelection>
 
diff --git a/src/Album/AlbTextEditorSelectionRecorder.class.st b/src/Album/AlbTextEditorSelectionRecorder.class.st
index d8d13fe..add009a 100644
--- a/src/Album/AlbTextEditorSelectionRecorder.class.st
+++ b/src/Album/AlbTextEditorSelectionRecorder.class.st
@@ -1,40 +1,38 @@
 Class {
-	#name : 'AlbTextEditorSelectionRecorder',
-	#superclass : 'Object',
-	#category : 'Album-Model-Selection',
-	#package : 'Album',
-	#tag : 'Model-Selection'
+	#name : #AlbTextEditorSelectionRecorder,
+	#superclass : #Object,
+	#category : 'Album-Model-Selection'
 }
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionRecorder >> commit: aTextEditor [
 	"Commit recorded selection intervals in a given text editor"
 	
 	self subclassResponsibility
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionRecorder >> deselect: aMonotoneTextSelection in: aTextEditor [
 	"Remove a given selection from recorded selections"
 	
 	self subclassResponsibility
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionRecorder >> prepare: aTextEditor [
 	"Prepare recorder for accepting selection intervals"
 	
 	^ self subclassResponsibility
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionRecorder >> select: aMonotoneTextSelection in: aTextEditor [
 	"Add a given selection to the list of recorded selections"
 	
 	self subclassResponsibility
 ]
 
-{ #category : 'selection' }
+{ #category : #selection }
 AlbTextEditorSelectionRecorder >> selection [
 	"Return current recorded selection"
 	<return: #BlSelection>
diff --git a/src/Album/AlbTextEditorSelectionUpdateCommand.class.st b/src/Album/AlbTextEditorSelectionUpdateCommand.class.st
index 32b48cd..8b4ae34 100644
--- a/src/Album/AlbTextEditorSelectionUpdateCommand.class.st
+++ b/src/Album/AlbTextEditorSelectionUpdateCommand.class.st
@@ -2,18 +2,16 @@
 I do the hard job of visually updating selection by requesting segment holders to partially update themselves
 "
 Class {
-	#name : 'AlbTextEditorSelectionUpdateCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorSelectionUpdateCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorSelectionUpdateCommand >> executeOn: aTextEditor [
 
 	| changedFrom changedTo |
@@ -33,27 +31,27 @@ AlbTextEditorSelectionUpdateCommand >> executeOn: aTextEditor [
 	aTextEditor notifyItems: (changedFrom to: changedTo) event: self newHolderEvent
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionUpdateCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionUpdateCommand >> fromIndex: anObject [
 	fromIndex := anObject
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorSelectionUpdateCommand >> newHolderEvent [
 	^ AlbTextEditorSelectionChangedHolderEvent new
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionUpdateCommand >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSelectionUpdateCommand >> toIndex: anObject [
 	toIndex := anObject
 ]
diff --git a/src/Album/AlbTextEditorShortcuts.class.st b/src/Album/AlbTextEditorShortcuts.class.st
index 94533a8..c833cbd 100644
--- a/src/Album/AlbTextEditorShortcuts.class.st
+++ b/src/Album/AlbTextEditorShortcuts.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextEditorShortcuts',
-	#superclass : 'Object',
+	#name : #AlbTextEditorShortcuts,
+	#superclass : #Object,
 	#instVars : [
 		'shortcuts'
 	],
-	#category : 'Album-Model',
-	#package : 'Album',
-	#tag : 'Model'
+	#category : 'Album-Model'
 }
 
-{ #category : 'adding / removing' }
+{ #category : #'adding / removing' }
 AlbTextEditorShortcuts >> add: aNewEditorShortcut ifAdded: anAddedBlock ifReplaced: aReplacedBlock [
 	"I add a new interaction shortcut or replace an existing one for the same combination and evaluate aReplacedBlock if it was the case"
 
@@ -24,24 +22,24 @@ AlbTextEditorShortcuts >> add: aNewEditorShortcut ifAdded: anAddedBlock ifReplac
 			anAddedBlock value: aNewEditorShortcut ]
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorShortcuts >> do: aBlock [
 	shortcuts do: aBlock
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorShortcuts >> initialize [
 	super initialize.
 	
 	shortcuts := Dictionary new
 ]
 
-{ #category : 'copying' }
+{ #category : #copying }
 AlbTextEditorShortcuts >> postCopy [
 	shortcuts := shortcuts copy
 ]
 
-{ #category : 'adding / removing' }
+{ #category : #'adding / removing' }
 AlbTextEditorShortcuts >> remove: anEditorShortcut ifFound: aFoundBlock [
 	
 	shortcuts
@@ -53,7 +51,7 @@ AlbTextEditorShortcuts >> remove: anEditorShortcut ifFound: aFoundBlock [
 					aFoundBlock value: anExistingEditorShortcut ] ]
 ]
 
-{ #category : 'adding / removing' }
+{ #category : #'adding / removing' }
 AlbTextEditorShortcuts >> removeAllShortcutsAndDo: aFoundBlock [
 	| theOldShortcuts |
 	
diff --git a/src/Album/AlbTextEditorShortcutsMemento.class.st b/src/Album/AlbTextEditorShortcutsMemento.class.st
index 26ca7fe..5c903e0 100644
--- a/src/Album/AlbTextEditorShortcutsMemento.class.st
+++ b/src/Album/AlbTextEditorShortcutsMemento.class.st
@@ -1,42 +1,40 @@
 Class {
-	#name : 'AlbTextEditorShortcutsMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorShortcutsMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'shortcuts'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorShortcutsMemento >> initialize [
 	super initialize.
 	
 	shortcuts := AlbTextEditorShortcuts new
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorShortcutsMemento >> label [
 	^ 'Shortcuts'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorShortcutsMemento >> order [
 	^ 10
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorShortcutsMemento >> restoreStateOf: aTextEditor [
 	aTextEditor setEditorShortcuts: shortcuts copy
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorShortcutsMemento >> saveStateOf: aTextEditor [
 	shortcuts := aTextEditor editorShortcuts copy
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorShortcutsMemento >> value [
 	^ shortcuts
 ]
diff --git a/src/Album/AlbTextEditorShowCursorRequest.class.st b/src/Album/AlbTextEditorShowCursorRequest.class.st
index 9cf86b7..2ef1425 100644
--- a/src/Album/AlbTextEditorShowCursorRequest.class.st
+++ b/src/Album/AlbTextEditorShowCursorRequest.class.st
@@ -1,23 +1,21 @@
 Class {
-	#name : 'AlbTextEditorShowCursorRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorShowCursorRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'cursorPosition',
 		'hasFocus'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorShowCursorRequest >> cursorPosition [
 	<return: #Number>
 
 	^ cursorPosition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorShowCursorRequest >> cursorPosition: aNumber [
 	
 	self
@@ -27,12 +25,12 @@ AlbTextEditorShowCursorRequest >> cursorPosition: aNumber [
 	cursorPosition := aNumber
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorShowCursorRequest >> hasFocus [
 	^ hasFocus
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorShowCursorRequest >> hasFocus: anObject [
 	hasFocus := anObject
 ]
diff --git a/src/Album/AlbTextEditorSingleCursor.class.st b/src/Album/AlbTextEditorSingleCursor.class.st
index 1c67cce..5aed01d 100644
--- a/src/Album/AlbTextEditorSingleCursor.class.st
+++ b/src/Album/AlbTextEditorSingleCursor.class.st
@@ -1,22 +1,20 @@
 Class {
-	#name : 'AlbTextEditorSingleCursor',
-	#superclass : 'AlbTextEditorCursor',
+	#name : #AlbTextEditorSingleCursor,
+	#superclass : #AlbTextEditorCursor,
 	#instVars : [
 		'position',
 		'isVisible',
 		'desiredCoordinate'
 	],
-	#category : 'Album-Model-Cursor',
-	#package : 'Album',
-	#tag : 'Model-Cursor'
+	#category : 'Album-Model-Cursor'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor class >> at: aTextIndex [
 	^ self new position: aTextIndex
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorSingleCursor >> = anotherObject [
 	self == anotherObject
 		ifTrue: [ ^ true ].
@@ -26,36 +24,36 @@ AlbTextEditorSingleCursor >> = anotherObject [
 	^ anotherObject position = self position
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> desiredCoordinate [
 	<return: #Number>
 
 	^ desiredCoordinate
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> desiredCoordinate: aNumber [
 	desiredCoordinate := aNumber
 ]
 
-{ #category : 'enumerating' }
+{ #category : #enumerating }
 AlbTextEditorSingleCursor >> do: aBlock [
 	aBlock value: self
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSingleCursor >> hasDesiredCoordinate [
 	<return: #Boolean>
 
 	^ desiredCoordinate isNotNil
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextEditorSingleCursor >> hash [
 	^ self class hash bitXor: self position hash
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSingleCursor >> initialize [
 	super initialize.
 	
@@ -65,7 +63,7 @@ AlbTextEditorSingleCursor >> initialize [
 	isVisible := false
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSingleCursor >> insideSegment: aSegment [
 	"Return true if I am inside of a given segment"
 	<return: #Boolean>
@@ -73,7 +71,7 @@ AlbTextEditorSingleCursor >> insideSegment: aSegment [
 	^ self position between: aSegment textStart and: aSegment textEnd
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorSingleCursor >> insideSubText: aTextEditorSegmentPiece of: aSegment [
 	"Return true if I am inside a given subtext, false otherwise"
 	<return: #Boolean>
@@ -84,7 +82,7 @@ AlbTextEditorSingleCursor >> insideSubText: aTextEditorSegmentPiece of: aSegment
 			and: [ self position between: aSegment textStart and: aSegment textEnd ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> isVisible [
 	"Return true if this cursor should be visible, false otherwise"
 	<return: #Boolean>
@@ -92,12 +90,12 @@ AlbTextEditorSingleCursor >> isVisible [
 	^ isVisible
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> isVisible: aBoolean [
 	isVisible := aBoolean
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> position [
 	"Return position of the cursor within the text"
 	<return: #Number>
@@ -105,7 +103,7 @@ AlbTextEditorSingleCursor >> position [
 	^ position
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> position: anIndex [
 	self
 		assert: [ anIndex >= 0 ]
@@ -114,7 +112,7 @@ AlbTextEditorSingleCursor >> position: anIndex [
 	position := anIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSingleCursor >> resetDesiredCoordinate [
 	desiredCoordinate := nil
 ]
diff --git a/src/Album/AlbTextEditorSplitter.class.st b/src/Album/AlbTextEditorSplitter.class.st
index 31f7aaa..4cc9759 100644
--- a/src/Album/AlbTextEditorSplitter.class.st
+++ b/src/Album/AlbTextEditorSplitter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorSplitter',
-	#superclass : 'Object',
-	#category : 'Album-Model-Segment-Text',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text'
+	#name : #AlbTextEditorSplitter,
+	#superclass : #Object,
+	#category : 'Album-Model-Segment-Text'
 }
 
-{ #category : 'api - splitting' }
+{ #category : #'api - splitting' }
 AlbTextEditorSplitter >> split: aBlText in: aEditorSegmentStream [
 	self
 		split: (aBlText from: 1 to: aBlText size)
@@ -14,7 +12,7 @@ AlbTextEditorSplitter >> split: aBlText in: aEditorSegmentStream [
 		offset: 0
 ]
 
-{ #category : 'api - splitting' }
+{ #category : #'api - splitting' }
 AlbTextEditorSplitter >> split: aText in: aEditorSegmentStream offset: anOffset [
 	self subclassResponsibility
 ]
diff --git a/src/Album/AlbTextEditorStylerMemento.class.st b/src/Album/AlbTextEditorStylerMemento.class.st
index 65a5f01..d70fd7a 100644
--- a/src/Album/AlbTextEditorStylerMemento.class.st
+++ b/src/Album/AlbTextEditorStylerMemento.class.st
@@ -1,40 +1,38 @@
 Class {
-	#name : 'AlbTextEditorStylerMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorStylerMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'styler'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorStylerMemento >> label [
 	^ 'Styler'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorStylerMemento >> order [
 	^ 40
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorStylerMemento >> restoreStateOf: aTextEditor [
 	aTextEditor styler: styler
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorStylerMemento >> saveStateOf: aTextEditor [
 	styler := aTextEditor styler
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorStylerMemento >> styler: anObject [
 	styler := anObject
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorStylerMemento >> value [
 	^ styler
 ]
diff --git a/src/Album/AlbTextEditorSurroundDefinition.class.st b/src/Album/AlbTextEditorSurroundDefinition.class.st
index 7cdf943..4a80241 100644
--- a/src/Album/AlbTextEditorSurroundDefinition.class.st
+++ b/src/Album/AlbTextEditorSurroundDefinition.class.st
@@ -14,44 +14,42 @@ Some characters, e.g. quotes, should only be inserted if surrounded by spaces.
 !!!Implementation Points
 "
 Class {
-	#name : 'AlbTextEditorSurroundDefinition',
-	#superclass : 'Object',
+	#name : #AlbTextEditorSurroundDefinition,
+	#superclass : #Object,
 	#instVars : [
 		'openCharacter',
 		'closeCharacter',
 		'condition'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> closeCharacter [
 	^ closeCharacter
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> closeCharacter: anObject [
 	closeCharacter := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> condition [
 	^ condition
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> condition: anObject [
 	condition := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> openCharacter [
 	^ openCharacter
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundDefinition >> openCharacter: anObject [
 	openCharacter := anObject
 ]
diff --git a/src/Album/AlbTextEditorSurroundMap.class.st b/src/Album/AlbTextEditorSurroundMap.class.st
index 1c6e712..e3e429d 100644
--- a/src/Album/AlbTextEditorSurroundMap.class.st
+++ b/src/Album/AlbTextEditorSurroundMap.class.st
@@ -15,22 +15,20 @@ See AlbTextEditorSurroundDefinition for more information.
 The size of the collection is assumed to be small, so a simple search is done instead of using a Dictionary.
 "
 Class {
-	#name : 'AlbTextEditorSurroundMap',
-	#superclass : 'Object',
+	#name : #AlbTextEditorSurroundMap,
+	#superclass : #Object,
 	#instVars : [
 		'definitions'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorSurroundMap class >> newFromArray: anArrayOfArray [
 	^ self newFromArrays: { anArrayOfArray }
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextEditorSurroundMap class >> newFromArrays: anArrayOfArray [
 	"When inserting some special symbols a text editor should surround a cursor or selection with that symbol
 	anArrayOfArray is:
@@ -46,19 +44,19 @@ AlbTextEditorSurroundMap class >> newFromArrays: anArrayOfArray [
 	^ self new addDefinitions: theDefinitions.
 ]
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbTextEditorSurroundMap >> addDefinition: aTextEditorSurroundDefinition [
 
 	definitions := definitions copyWith: aTextEditorSurroundDefinition
 ]
 
-{ #category : 'adding' }
+{ #category : #adding }
 AlbTextEditorSurroundMap >> addDefinitions: anArray [
 
 	definitions := definitions, anArray
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> associations [
 	"Answer an array of openCharacter -> closeCharacter associations"
 
@@ -66,7 +64,7 @@ AlbTextEditorSurroundMap >> associations [
 		definition openCharacter -> definition closeCharacter ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> closingFor: aCharacter ifPresent: presentBlock ifAbsent: absentBlock [
 	"Answer the matching closing character for the supplied opening character"
 	| definition |
@@ -77,7 +75,7 @@ AlbTextEditorSurroundMap >> closingFor: aCharacter ifPresent: presentBlock ifAbs
 	^presentBlock value: definition closeCharacter.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> closingFor: aCharacter in: anOperator at: anIndex ifPresent: presentBlock ifAbsent: absentBlock [
 	"Answer the matching closing character for the supplied opening character.
 	If the receiver has a condition block that evaluates to false, execute the absentBlock."
@@ -92,19 +90,19 @@ AlbTextEditorSurroundMap >> closingFor: aCharacter in: anOperator at: anIndex if
 	^presentBlock value: definition closeCharacter.
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> definitions [
 	^definitions
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorSurroundMap >> initialize [ 
 
 	super initialize.
 	definitions := #().
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> intervalBetweenDelimitersIn: aText at: aPosition ifPresent: aBlockWithIntervalArg ifAbsent: anAbsentBlock [
 
 	" if aString at aPosition is just after of just before a delimiter, then look for the opposite delimiter. If found, then aBlockWithIntervalArg is runned with the interval between delimiters as argument else, anAbsentBlock is runned "
@@ -133,7 +131,7 @@ AlbTextEditorSurroundMap >> intervalBetweenDelimitersIn: aText at: aPosition ifP
 				                                  ifAbsent: [ ^ anAbsentBlock value ] ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorSurroundMap >> openingFor: aCharacter ifPresent: presentBlock ifAbsent: absentBlock [
 	"Answer the matching opening character for the supplied closing character"
 	| definition |
@@ -144,7 +142,7 @@ AlbTextEditorSurroundMap >> openingFor: aCharacter ifPresent: presentBlock ifAbs
 	^presentBlock value: definition openCharacter.
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorSurroundMap >> positionOf: aDelim from: startDelim startingAt: aPosition in: aText forward: aBoolean [
 	" scan into a text aText, forward or backward, to search the position of aDelim which is the opposite delim of startDelim."
 	| level here hereChar incr |
@@ -167,7 +165,7 @@ AlbTextEditorSurroundMap >> positionOf: aDelim from: startDelim startingAt: aPos
 	^ 0
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorSurroundMap >> positionOfClosingDelimiter: aDelim startingAt: aPosition in: aText [
 
 	" return the position of the closing delim aDelim "
@@ -182,7 +180,7 @@ AlbTextEditorSurroundMap >> positionOfClosingDelimiter: aDelim startingAt: aPosi
 		  forward: true
 ]
 
-{ #category : 'private - accessing' }
+{ #category : #'private - accessing' }
 AlbTextEditorSurroundMap >> positionOfOpeningDelimiter: aDelim startingAt: aPosition in: aText [
 
 	" return the position of the opening delim aDelim "
diff --git a/src/Album/AlbTextEditorTextChangedHolderEvent.class.st b/src/Album/AlbTextEditorTextChangedHolderEvent.class.st
index b38eadf..ae901af 100644
--- a/src/Album/AlbTextEditorTextChangedHolderEvent.class.st
+++ b/src/Album/AlbTextEditorTextChangedHolderEvent.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextEditorTextChangedHolderEvent',
-	#superclass : 'AlbTextEditorHolderEvent',
-	#category : 'Album-Commands-Holder',
-	#package : 'Album',
-	#tag : 'Commands-Holder'
+	#name : #AlbTextEditorTextChangedHolderEvent,
+	#superclass : #AlbTextEditorHolderEvent,
+	#category : 'Album-Commands-Holder'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextEditorTextChangedHolderEvent >> sendTo: aSegmentHolder [
 	aSegmentHolder onTextChanged
 ]
diff --git a/src/Album/AlbTextEditorTextChangedRequest.class.st b/src/Album/AlbTextEditorTextChangedRequest.class.st
index 6dea8a4..359acac 100644
--- a/src/Album/AlbTextEditorTextChangedRequest.class.st
+++ b/src/Album/AlbTextEditorTextChangedRequest.class.st
@@ -1,53 +1,51 @@
 Class {
-	#name : 'AlbTextEditorTextChangedRequest',
-	#superclass : 'AlbTextEditorRequest',
+	#name : #AlbTextEditorTextChangedRequest,
+	#superclass : #AlbTextEditorRequest,
 	#instVars : [
 		'segmentPiece',
 		'text',
 		'textStart',
 		'textEnd'
 	],
-	#category : 'Album-UI-Requests',
-	#package : 'Album',
-	#tag : 'UI-Requests'
+	#category : 'Album-UI-Requests'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> segmentPiece [
 	^ segmentPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> segmentPiece: anObject [
 	segmentPiece := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> text: anObject [
 	text := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> textEnd [
 	^ textEnd
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> textEnd: anObject [
 	textEnd := anObject
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> textStart [
 	^ textStart
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextChangedRequest >> textStart: anObject [
 	textStart := anObject
 ]
diff --git a/src/Album/AlbTextEditorTextMemento.class.st b/src/Album/AlbTextEditorTextMemento.class.st
index 7e95d30..156915e 100644
--- a/src/Album/AlbTextEditorTextMemento.class.st
+++ b/src/Album/AlbTextEditorTextMemento.class.st
@@ -1,57 +1,55 @@
 Class {
-	#name : 'AlbTextEditorTextMemento',
-	#superclass : 'AlbTextEditorMemento',
+	#name : #AlbTextEditorTextMemento,
+	#superclass : #AlbTextEditorMemento,
 	#instVars : [
 		'text'
 	],
-	#category : 'Album-Model-Memento',
-	#package : 'Album',
-	#tag : 'Model-Memento'
+	#category : 'Album-Model-Memento'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorTextMemento >> initialize [
 	super initialize.
 	
 	text := '' asRopedText
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEditorTextMemento >> isTextMemento [
 	^ true
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorTextMemento >> label [
 	^ 'Text'
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextMemento >> order [
 	^ 60
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorTextMemento >> restoreStateOf: aTextEditor [
 	aTextEditor restoreText: text copy
 ]
 
-{ #category : 'memento' }
+{ #category : #memento }
 AlbTextEditorTextMemento >> saveStateOf: aTextEditor [
 	text := aTextEditor text copy
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextMemento >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorTextMemento >> text: anObject [
 	text := anObject
 ]
 
-{ #category : 'evaluating' }
+{ #category : #evaluating }
 AlbTextEditorTextMemento >> value [
 	^ text copyWithoutExternalReferences
 ]
diff --git a/src/Album/AlbTextEditorUpdateCommand.class.st b/src/Album/AlbTextEditorUpdateCommand.class.st
index 756642c..28f93c9 100644
--- a/src/Album/AlbTextEditorUpdateCommand.class.st
+++ b/src/Album/AlbTextEditorUpdateCommand.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbTextEditorUpdateCommand',
-	#superclass : 'AlbTextEditorCommand',
+	#name : #AlbTextEditorUpdateCommand,
+	#superclass : #AlbTextEditorCommand,
 	#instVars : [
 		'fromIndex',
 		'toIndex'
 	],
-	#category : 'Album-Commands',
-	#package : 'Album',
-	#tag : 'Commands'
+	#category : 'Album-Commands'
 }
 
-{ #category : 'executing' }
+{ #category : #executing }
 AlbTextEditorUpdateCommand >> executeOn: aTextEditor [
 	| changedFrom changedTo |
 	
@@ -33,22 +31,22 @@ AlbTextEditorUpdateCommand >> executeOn: aTextEditor [
 	aTextEditor notifyItemsChanged: (changedFrom to: changedTo)
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorUpdateCommand >> fromIndex [
 	^ fromIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorUpdateCommand >> fromIndex: aFromTextIndex [
 	fromIndex := aFromTextIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorUpdateCommand >> toIndex [
 	^ toIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEditorUpdateCommand >> toIndex: aToTextIndex [
 	toIndex := aToTextIndex
 ]
diff --git a/src/Album/AlbTextEditorUpdater.class.st b/src/Album/AlbTextEditorUpdater.class.st
index d583f6d..05e149f 100644
--- a/src/Album/AlbTextEditorUpdater.class.st
+++ b/src/Album/AlbTextEditorUpdater.class.st
@@ -1,34 +1,32 @@
 Class {
-	#name : 'AlbTextEditorUpdater',
-	#superclass : 'AlbTextEditorOperator',
+	#name : #AlbTextEditorUpdater,
+	#superclass : #AlbTextEditorOperator,
 	#instVars : [
 		'intervals',
 		'shouldRedraw',
 		'shouldRecreate'
 	],
-	#category : 'Album-Model-Operators',
-	#package : 'Album',
-	#tag : 'Model-Operators'
+	#category : 'Album-Model-Operators'
 }
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorUpdater >> all [
 	self from: 1 to: self text size
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorUpdater >> apply [
 	^ self update 
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorUpdater >> from: aFromTextIndex to: aToTextIndex [
 	"Both from and to indices must be given in text coordinates"
 
 	intervals add: (aFromTextIndex to: aToTextIndex)
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEditorUpdater >> initialize [
 	super initialize.
 	
@@ -37,13 +35,13 @@ AlbTextEditorUpdater >> initialize [
 	shouldRedraw := true
 ]
 
-{ #category : 'api - configuration' }
+{ #category : #'api - configuration' }
 AlbTextEditorUpdater >> redrawOnly [
 	shouldRedraw := true.
 	shouldRecreate := false
 ]
 
-{ #category : 'api - processing' }
+{ #category : #'api - processing' }
 AlbTextEditorUpdater >> update [
 	intervals do: [ :eachInterval |
 		(shouldRecreate not and: [ shouldRedraw ])
diff --git a/src/Album/AlbTextElement.class.st b/src/Album/AlbTextElement.class.st
index 4ee2566..1890ed5 100644
--- a/src/Album/AlbTextElement.class.st
+++ b/src/Album/AlbTextElement.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbTextElement',
-	#superclass : 'BlTextElement',
+	#name : #AlbTextElement,
+	#superclass : #BlTextElement,
 	#instVars : [
 		'cursorElement',
 		'segmentPiece'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'cursor - management' }
+{ #category : #'cursor - management' }
 AlbTextElement >> addCursorAt: aTextPosition inEditorElement: anEditorElement [
 
 	<return: #AlbCursorElement>
@@ -23,12 +21,12 @@ AlbTextElement >> addCursorAt: aTextPosition inEditorElement: anEditorElement [
 		  cursorElement ]
 ]
 
-{ #category : 'cursor - asserting' }
+{ #category : #'cursor - asserting' }
 AlbTextElement >> assertCursor: aCursorElement [
 	self assertCursorPosition: aCursorElement textPosition
 ]
 
-{ #category : 'cursor - asserting' }
+{ #category : #'cursor - asserting' }
 AlbTextElement >> assertCursorPosition: anIndex [
 	self
 		assert: [ self text isNotEmpty or: [ anIndex isZero ] ]
@@ -38,7 +36,7 @@ AlbTextElement >> assertCursorPosition: anIndex [
 		description: [ 'Cursor must be within text bounds (0 is allowed)' ].
 ]
 
-{ #category : 'cursor - accessing' }
+{ #category : #'cursor - accessing' }
 AlbTextElement >> cursorAt: aTextPosition ifFound: aFoundBlock ifNone: aNoneBlock [
 
 	cursorElement ifNil: [ ^ aNoneBlock value ].
@@ -47,7 +45,7 @@ AlbTextElement >> cursorAt: aTextPosition ifFound: aFoundBlock ifNone: aNoneBloc
 	^ aFoundBlock value: cursorElement
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextElement >> defaultMinWidth [
 
 	"to ensure that the clickable area is width enough event in case of fitContent"
@@ -55,13 +53,13 @@ AlbTextElement >> defaultMinWidth [
 	^ 2
 ]
 
-{ #category : 'cursor - accessing' }
+{ #category : #'cursor - accessing' }
 AlbTextElement >> hasCursor [
 
 	^ cursorElement notNil
 ]
 
-{ #category : 'cursor - accessing' }
+{ #category : #'cursor - accessing' }
 AlbTextElement >> hasCursorAt: aTextPosition [
 	"Return true if cursor at a given position exists"
 	<return: #Boolean>
@@ -72,13 +70,13 @@ AlbTextElement >> hasCursorAt: aTextPosition [
 		ifNone: [ false ]
 ]
 
-{ #category : 'cursor - management' }
+{ #category : #'cursor - management' }
 AlbTextElement >> hideCursor [
 	cursorElement ifNil: [ ^self ].
 	cursorElement visibility: BlVisibility gone
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextElement >> initialize [
 
 	super initialize.
@@ -86,7 +84,7 @@ AlbTextElement >> initialize [
 	self clipChildren: false.
 ]
 
-{ #category : 'layout' }
+{ #category : #layout }
 AlbTextElement >> layoutCursor: aBounds context: aBlElementBoundsUpdateContext [
 		| cursorPos textPosX maxTextPosX minTextPosX textPos |
 		cursorElement ifNil: [ ^self ].
@@ -105,20 +103,20 @@ AlbTextElement >> layoutCursor: aBounds context: aBlElementBoundsUpdateContext [
 			context: aBlElementBoundsUpdateContext
 ]
 
-{ #category : 'private - paragraph' }
+{ #category : #'private - paragraph' }
 AlbTextElement >> newTextParagraph [
 	"Create a text paragraph used to measure and render text"
 
 	^ AlbTextParagraph new segmentPiece: segmentPiece
 ]
 
-{ #category : 'layout' }
+{ #category : #layout }
 AlbTextElement >> onLayout: aBounds context: aBlElementBoundsUpdateContext [
 	super onLayout: aBounds context: aBlElementBoundsUpdateContext.	
 	self layoutCursor: aBounds context: aBlElementBoundsUpdateContext
 ]
 
-{ #category : 'cursor - management' }
+{ #category : #'cursor - management' }
 AlbTextElement >> removeCursorAt: aTextIndex [
 	"Remove cursor at a goven position"
 
@@ -131,14 +129,14 @@ AlbTextElement >> removeCursorAt: aTextIndex [
 		ifNone: [ self error: 'Cursor at ', aTextIndex asString, ' does not exist' ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextElement >> segmentPiece [
 	<return: #TAlbTextEditorTextualPiece>
 
 	^ segmentPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextElement >> segmentPiece: aSegmentPiece [
 
 	segmentPiece := aSegmentPiece.
@@ -146,13 +144,13 @@ AlbTextElement >> segmentPiece: aSegmentPiece [
 	self text: (aSegmentPiece text copyFrom: 1 to: aSegmentPiece text size)
 ]
 
-{ #category : 'cursor - management' }
+{ #category : #'cursor - management' }
 AlbTextElement >> showCursor [
 	cursorElement ifNil: [ ^self ].
 	cursorElement visibility: BlVisibility visible
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 AlbTextElement >> textEnd [
 	"Return an index of the last character of a subtext that I represent"
 	<return: #Number>
@@ -160,7 +158,7 @@ AlbTextElement >> textEnd [
 	^ segmentPiece textEnd
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 AlbTextElement >> textStart [
 	"Return an index of the first character of a subtext that I represent"
 	<return: #Number>
diff --git a/src/Album/AlbTextEmbellishmentAttribute.class.st b/src/Album/AlbTextEmbellishmentAttribute.class.st
index 79c835c..099ebf5 100644
--- a/src/Album/AlbTextEmbellishmentAttribute.class.st
+++ b/src/Album/AlbTextEmbellishmentAttribute.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextEmbellishmentAttribute',
-	#superclass : 'AlbTextAdornmentAttribute',
+	#name : #AlbTextEmbellishmentAttribute,
+	#superclass : #AlbTextAdornmentAttribute,
 	#instVars : [
 		'embellishment',
 		'padding',
 		'margin'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEmbellishmentAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -30,17 +28,17 @@ AlbTextEmbellishmentAttribute >> doAffect: aTTextEditorTextualPiece in: anEditor
 	}
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextEmbellishmentAttribute >> embellishment [
 	^ embellishment
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextEmbellishmentAttribute >> embellishment: anObject [
 	embellishment := anObject
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEmbellishmentAttribute >> initialize [
 	super initialize.
 	
@@ -49,29 +47,29 @@ AlbTextEmbellishmentAttribute >> initialize [
 	margin := BlInsets empty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEmbellishmentAttribute >> margin [
 	^ margin
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextEmbellishmentAttribute >> margin: anObject [
 	margin := anObject
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextEmbellishmentAttribute >> padding [
 	<return: #BlInsets>
 
 	^ padding
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextEmbellishmentAttribute >> padding: anObject [
 	padding := anObject
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextEmbellishmentAttribute >> roundedBackground: aPaint [
 	self embellishment: [ :anElement |
 		anElement background: aPaint.
diff --git a/src/Album/AlbTextEventHandlerAttribute.class.st b/src/Album/AlbTextEventHandlerAttribute.class.st
index 1a19c96..4234cc3 100644
--- a/src/Album/AlbTextEventHandlerAttribute.class.st
+++ b/src/Album/AlbTextEventHandlerAttribute.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextEventHandlerAttribute',
-	#superclass : 'BlTextAttribute',
+	#name : #AlbTextEventHandlerAttribute,
+	#superclass : #BlTextAttribute,
 	#traits : 'TBlEventTarget',
 	#classTraits : 'TBlEventTarget classTrait',
 	#instVars : [
 		'eventDispatcher'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'event management accessing' }
+{ #category : #'event management accessing' }
 AlbTextEventHandlerAttribute >> eventDispatcher [
 	"Return an object responsible for event dispatching"
 	<return: #BlDirectEventDispatcher>
@@ -19,19 +17,19 @@ AlbTextEventHandlerAttribute >> eventDispatcher [
 	^ eventDispatcher 
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextEventHandlerAttribute >> handleEvent: aBlEvent [
 	self dispatchEvent: aBlEvent
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextEventHandlerAttribute >> initialize [
 	super initialize.
 	eventDispatcher := BlDirectEventDispatcher on: self.
 
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextEventHandlerAttribute >> isEventHandler [
 	"Return true if attribute is designed to handle UI events such as mouse,
 	false otherwise"
@@ -40,7 +38,7 @@ AlbTextEventHandlerAttribute >> isEventHandler [
 	^ true
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextEventHandlerAttribute >> wantsEvent: aBlEvent [
 
 Transcript show: 'wantsEvent: ', aBlEvent asString, ' ^ ', (self eventDispatcher wantsEvent: aBlEvent) asString; cr.
diff --git a/src/Album/AlbTextExpandButtonAttribute.class.st b/src/Album/AlbTextExpandButtonAttribute.class.st
index d391454..1315057 100644
--- a/src/Album/AlbTextExpandButtonAttribute.class.st
+++ b/src/Album/AlbTextExpandButtonAttribute.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextExpandButtonAttribute',
-	#superclass : 'AlbTextAdornmentAttribute',
+	#name : #AlbTextExpandButtonAttribute,
+	#superclass : #AlbTextAdornmentAttribute,
 	#instVars : [
 		'isExpanded',
 		'attributesCreatingBlock',
 		'createdAttributes'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextExpandButtonAttribute >> applyExpandedOrCollapsedAttributesOn: aTTextEditorTextualPiece in: aTextEditor [
 	"Add attributes if expanded and remove if collapsed"
 	| aText |
@@ -24,17 +22,17 @@ AlbTextExpandButtonAttribute >> applyExpandedOrCollapsedAttributesOn: aTTextEdit
 		ifTrue: [ self createAttributesAffect: aText in: aTextEditor ]
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> attributesCreatingBlock [
 	^ attributesCreatingBlock
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> attributesCreatingBlock: aBlock [
 	attributesCreatingBlock := aBlock
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextExpandButtonAttribute >> createAttributesAffect: aText in: aTextEditor [
 	createdAttributes := (attributesCreatingBlock
 		cull: aText
@@ -42,17 +40,17 @@ AlbTextExpandButtonAttribute >> createAttributesAffect: aText in: aTextEditor [
 	aText attributes: createdAttributes
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> createdAttributes [
 	^ createdAttributes
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> createdAttributes: aCollection [
 	createdAttributes := aCollection
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextExpandButtonAttribute >> initialize [
 	super initialize.
 	
@@ -63,17 +61,17 @@ AlbTextExpandButtonAttribute >> initialize [
 	createdAttributes := OrderedCollection new
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> isExpanded [
 	^ isExpanded
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextExpandButtonAttribute >> isExpanded: aBoolean [
 	isExpanded := aBoolean
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextExpandButtonAttribute >> toggleExpandedOrCollapsedAttributesOn: aTTextEditorTextualPiece in: aTextEditor [
 	self isExpanded: isExpanded not.
 	self applyExpandedOrCollapsedAttributesOn: aTTextEditorTextualPiece in: aTextEditor
diff --git a/src/Album/AlbTextFieldEditor.class.st b/src/Album/AlbTextFieldEditor.class.st
index d8c3dd3..c826b33 100644
--- a/src/Album/AlbTextFieldEditor.class.st
+++ b/src/Album/AlbTextFieldEditor.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextFieldEditor',
-	#superclass : 'AlbTextEditor',
-	#category : 'Album-Model',
-	#package : 'Album',
-	#tag : 'Model'
+	#name : #AlbTextFieldEditor,
+	#superclass : #AlbTextEditor,
+	#category : 'Album-Model'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextFieldEditor >> defaultSegmentCollector [
 
 	^ AlbTextFieldEditorSegmentCollector new 
diff --git a/src/Album/AlbTextFieldEditorLineSegment.class.st b/src/Album/AlbTextFieldEditorLineSegment.class.st
index 328da3b..b6dcf2c 100644
--- a/src/Album/AlbTextFieldEditorLineSegment.class.st
+++ b/src/Album/AlbTextFieldEditorLineSegment.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextFieldEditorLineSegment',
-	#superclass : 'AlbTextEditorLineSegment',
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#name : #AlbTextFieldEditorLineSegment,
+	#superclass : #AlbTextEditorLineSegment,
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'pieces - computation' }
+{ #category : #'pieces - computation' }
 AlbTextFieldEditorLineSegment >> newSplitter [
 
 	^ AlbTextEditorLineSegmentSplitter new
diff --git a/src/Album/AlbTextFieldEditorLineSplitter.class.st b/src/Album/AlbTextFieldEditorLineSplitter.class.st
index 7abca41..0d840d4 100644
--- a/src/Album/AlbTextFieldEditorLineSplitter.class.st
+++ b/src/Album/AlbTextFieldEditorLineSplitter.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextFieldEditorLineSplitter',
-	#superclass : 'AlbTextEditorLineSplitter',
-	#category : 'Album-Model-Segment-Text-Line',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text-Line'
+	#name : #AlbTextFieldEditorLineSplitter,
+	#superclass : #AlbTextEditorLineSplitter,
+	#category : 'Album-Model-Segment-Text-Line'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextFieldEditorLineSplitter >> newSegment [
 	^ AlbTextFieldEditorLineSegment new
 ]
diff --git a/src/Album/AlbTextFieldEditorSegmentCollector.class.st b/src/Album/AlbTextFieldEditorSegmentCollector.class.st
index 6937efa..5336531 100644
--- a/src/Album/AlbTextFieldEditorSegmentCollector.class.st
+++ b/src/Album/AlbTextFieldEditorSegmentCollector.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextFieldEditorSegmentCollector',
-	#superclass : 'AlbTextEditorSegmentCollector',
-	#category : 'Album-Model-Segment-Text',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text'
+	#name : #AlbTextFieldEditorSegmentCollector,
+	#superclass : #AlbTextEditorSegmentCollector,
+	#category : 'Album-Model-Segment-Text'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextFieldEditorSegmentCollector >> defaultSplitter [
 
 	^ AlbTextFieldEditorLineSplitter new
diff --git a/src/Album/AlbTextFieldElement.class.st b/src/Album/AlbTextFieldElement.class.st
index df1bace..0b16793 100644
--- a/src/Album/AlbTextFieldElement.class.st
+++ b/src/Album/AlbTextFieldElement.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextFieldElement',
-	#superclass : 'AlbEditorElement',
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#name : #AlbTextFieldElement,
+	#superclass : #AlbEditorElement,
+	#category : 'Album-UI'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextFieldElement >> defaultInfiniteElement [  
 
 	^ AlbInfiniteTextFieldElement new
diff --git a/src/Album/AlbTextHideAttribute.class.st b/src/Album/AlbTextHideAttribute.class.st
index d22e974..bdc5281 100644
--- a/src/Album/AlbTextHideAttribute.class.st
+++ b/src/Album/AlbTextHideAttribute.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextHideAttribute',
-	#superclass : 'AlbTextAdornmentAttribute',
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#name : #AlbTextHideAttribute,
+	#superclass : #AlbTextAdornmentAttribute,
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHideAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -14,7 +12,7 @@ AlbTextHideAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	^ #()
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextHideAttribute >> initialize [
 	super initialize.
 	
diff --git a/src/Album/AlbTextHoverAttribute.class.st b/src/Album/AlbTextHoverAttribute.class.st
index 1b1a12b..0b4cc61 100644
--- a/src/Album/AlbTextHoverAttribute.class.st
+++ b/src/Album/AlbTextHoverAttribute.class.st
@@ -1,27 +1,25 @@
 Class {
-	#name : 'AlbTextHoverAttribute',
-	#superclass : 'AlbTextCrappyEventHandlerAttribute',
+	#name : #AlbTextHoverAttribute,
+	#superclass : #AlbTextCrappyEventHandlerAttribute,
 	#instVars : [
 		'enterAction',
 		'leaveAction',
 		'isHovered'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverAttribute >> enterAction [
 	^ enterAction
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverAttribute >> enterAction: anObject [
 	enterAction := anObject
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextHoverAttribute >> handleEvent: anEvent [ 
 	"Handle a given event or dispatch it using #sendTo:"
 
@@ -32,7 +30,7 @@ AlbTextHoverAttribute >> handleEvent: anEvent [
 		ifTrue: [ self performLeaveAction: anEvent ].
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextHoverAttribute >> initialize [
 	super initialize.
 
@@ -41,12 +39,12 @@ AlbTextHoverAttribute >> initialize [
 	isHovered := false
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverAttribute >> leaveAction [
 	^ leaveAction
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverAttribute >> leaveAction: aBlock [
 	self 
 		assert: [ aBlock notNil ] 
@@ -55,7 +53,7 @@ AlbTextHoverAttribute >> leaveAction: aBlock [
 	leaveAction := aBlock
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextHoverAttribute >> performEnterAction: anEvent [ 
 
 	isHovered ifTrue: [ ^ self ].
@@ -69,7 +67,7 @@ AlbTextHoverAttribute >> performEnterAction: anEvent [
 		value: anEvent wrappedEvent
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextHoverAttribute >> performLeaveAction: anEvent [ 
 
 	isHovered ifFalse: [ ^ self ].
@@ -83,7 +81,7 @@ AlbTextHoverAttribute >> performLeaveAction: anEvent [
 		value: anEvent wrappedEvent
 ]
 
-{ #category : 'events' }
+{ #category : #events }
 AlbTextHoverAttribute >> wantsEvent: anEvent [
 	"Return true if I am interested in a given event and want to handle it,
 	false otherwise"
diff --git a/src/Album/AlbTextHoverStylableAttribute.class.st b/src/Album/AlbTextHoverStylableAttribute.class.st
index ba97073..27e94c0 100644
--- a/src/Album/AlbTextHoverStylableAttribute.class.st
+++ b/src/Album/AlbTextHoverStylableAttribute.class.st
@@ -2,33 +2,31 @@
 I add attributes to a piece of text when user hovers it with a mouse, then I remove those attributes when the mouse is no longer over the text
 "
 Class {
-	#name : 'AlbTextHoverStylableAttribute',
-	#superclass : 'AlbTextHoverAttribute',
+	#name : #AlbTextHoverStylableAttribute,
+	#superclass : #AlbTextHoverAttribute,
 	#instVars : [
 		'attributes'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverStylableAttribute >> attribute: aTextAttribute [
 	self attributes: { aTextAttribute }
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverStylableAttribute >> attributes [
 	^ attributes
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextHoverStylableAttribute >> attributes: aCollectionOfAttributes [
 	"Set a collection of attribtues that should be added when user hover a text with a mouse"
 	attributes := aCollectionOfAttributes
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextHoverStylableAttribute >> initialize [
 	super initialize.
 
diff --git a/src/Album/AlbTextInsertedEvent.class.st b/src/Album/AlbTextInsertedEvent.class.st
index 2c91558..18f8fc5 100644
--- a/src/Album/AlbTextInsertedEvent.class.st
+++ b/src/Album/AlbTextInsertedEvent.class.st
@@ -1,16 +1,14 @@
 Class {
-	#name : 'AlbTextInsertedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextInsertedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'text',
 		'index'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextInsertedEvent class >> text: aBlText at: anIndex [
 	<return: #AlbTextInsertedEvent>
 
@@ -19,22 +17,22 @@ AlbTextInsertedEvent class >> text: aBlText at: anIndex [
 		index: anIndex
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextInsertedEvent >> index [
 	^ index
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextInsertedEvent >> index: aNumber [
 	index := aNumber
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextInsertedEvent >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextInsertedEvent >> text: aText [
 	text := aText
 ]
diff --git a/src/Album/AlbTextInvisibleMarkerAttribute.class.st b/src/Album/AlbTextInvisibleMarkerAttribute.class.st
index c915b5f..4313ea2 100644
--- a/src/Album/AlbTextInvisibleMarkerAttribute.class.st
+++ b/src/Album/AlbTextInvisibleMarkerAttribute.class.st
@@ -2,14 +2,12 @@
 I am a special marker attribute that is intended to be used together with `{method:BlText>>#findAttribute:indicesDo:}` to dynamically find text interval indices
 "
 Class {
-	#name : 'AlbTextInvisibleMarkerAttribute',
-	#superclass : 'BlTextAttribute',
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#name : #AlbTextInvisibleMarkerAttribute,
+	#superclass : #BlTextAttribute,
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextInvisibleMarkerAttribute >> type [
 	^ self
 ]
diff --git a/src/Album/AlbTextParagraph.class.st b/src/Album/AlbTextParagraph.class.st
index b417f97..4bfd0db 100644
--- a/src/Album/AlbTextParagraph.class.st
+++ b/src/Album/AlbTextParagraph.class.st
@@ -2,29 +2,27 @@
 Kept for now but will be removed in the futur 
 "
 Class {
-	#name : 'AlbTextParagraph',
-	#superclass : 'BlTextParagraph',
+	#name : #AlbTextParagraph,
+	#superclass : #BlTextParagraph,
 	#instVars : [
 		'segmentPiece'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 'paragraph - measuring' }
+{ #category : #'paragraph - measuring' }
 AlbTextParagraph >> emptySpan [
 
 	^ BlSpan text: BlText empty attributes: (segmentPiece text iterator attributes reject: [ :a | a isEventHandler ])
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraph >> segmentPiece: aSegmentPiece [
 
 	segmentPiece := aSegmentPiece
 ]
 
-{ #category : 'api - compositing' }
+{ #category : #'api - compositing' }
 AlbTextParagraph >> wantsSeparateCompositingLayer [
 
 	^ false
diff --git a/src/Album/AlbTextParagraphAttribute.class.st b/src/Album/AlbTextParagraphAttribute.class.st
index 674172f..1df1646 100644
--- a/src/Album/AlbTextParagraphAttribute.class.st
+++ b/src/Album/AlbTextParagraphAttribute.class.st
@@ -4,18 +4,16 @@ I am an attribute that is intended to be applied on a multi-line piece of text.
 I should be treated differently by text widgets with the support of multi-line text than normal text attributes. One example of a paragraph attribute is line-spacing
 "
 Class {
-	#name : 'AlbTextParagraphAttribute',
-	#superclass : 'BlTextAttribute',
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#name : #AlbTextParagraphAttribute,
+	#superclass : #BlTextAttribute,
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'hook' }
+{ #category : #hook }
 AlbTextParagraphAttribute >> applyOn: aTextParagraph [
 ]
 
-{ #category : 'testing' }
+{ #category : #testing }
 AlbTextParagraphAttribute >> isParagraphAttribute [
 	"Return true if I am a special paragraph attribute, false otherwise"
 	<return: #Boolean>
diff --git a/src/Album/AlbTextParagraphLineSpacingAttribute.class.st b/src/Album/AlbTextParagraphLineSpacingAttribute.class.st
index 46ad403..101e1f4 100644
--- a/src/Album/AlbTextParagraphLineSpacingAttribute.class.st
+++ b/src/Album/AlbTextParagraphLineSpacingAttribute.class.st
@@ -4,51 +4,49 @@ I influence a line spacing of a paragraph of text.
 Example:
 "
 Class {
-	#name : 'AlbTextParagraphLineSpacingAttribute',
-	#superclass : 'AlbTextParagraphAttribute',
+	#name : #AlbTextParagraphLineSpacingAttribute,
+	#superclass : #AlbTextParagraphAttribute,
 	#instVars : [
 		'lineSpacing'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextParagraphLineSpacingAttribute class >> lineSpacing: aNumber [
 	^ self new lineSpacing: aNumber
 ]
 
-{ #category : 'hook' }
+{ #category : #hook }
 AlbTextParagraphLineSpacingAttribute >> applyOn: aTextParagraph [
 	aTextParagraph lineSpacing: self lineSpacing
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphLineSpacingAttribute >> equals: anAnotherAttribute [
 	^ self lineSpacing = anAnotherAttribute lineSpacing
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphLineSpacingAttribute >> hash [
 	"Answer an integer value that is related to the identity of the receiver."
 
 	^ super hash bitXor: self lineSpacing hash
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextParagraphLineSpacingAttribute >> initialize [
 	super initialize.
 	
 	lineSpacing := 0
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphLineSpacingAttribute >> lineSpacing [
 	^ lineSpacing
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphLineSpacingAttribute >> lineSpacing: aNumber [
 	lineSpacing := aNumber
 ]
diff --git a/src/Album/AlbTextParagraphMarginAttribute.class.st b/src/Album/AlbTextParagraphMarginAttribute.class.st
index 02c5015..a2afe37 100644
--- a/src/Album/AlbTextParagraphMarginAttribute.class.st
+++ b/src/Album/AlbTextParagraphMarginAttribute.class.st
@@ -1,51 +1,49 @@
 Class {
-	#name : 'AlbTextParagraphMarginAttribute',
-	#superclass : 'AlbTextParagraphAttribute',
+	#name : #AlbTextParagraphMarginAttribute,
+	#superclass : #AlbTextParagraphAttribute,
 	#instVars : [
 		'paragraphMargin'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextParagraphMarginAttribute class >> paragraphMargin: anInsets [
 	^ self new paragraphMargin: anInsets
 ]
 
-{ #category : 'hook' }
+{ #category : #hook }
 AlbTextParagraphMarginAttribute >> applyOn: aTextParagraph [
 	aTextParagraph paragraphMargin: self paragraphMargin
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphMarginAttribute >> equals: anAnotherAttribute [
 	^ self paragraphMargin = anAnotherAttribute paragraphMargin
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphMarginAttribute >> hash [
 	"Answer an integer value that is related to the identity of the receiver."
 
 	^ super hash bitXor: self paragraphMargin hash
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextParagraphMarginAttribute >> initialize [
 	super initialize.
 
 	paragraphMargin := BlInsets empty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphMarginAttribute >> paragraphMargin [
 	<return: #BlInsets>
 
 	^ paragraphMargin
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphMarginAttribute >> paragraphMargin: anInsets [
 	paragraphMargin := anInsets
 ]
diff --git a/src/Album/AlbTextParagraphWordPaddingAttribute.class.st b/src/Album/AlbTextParagraphWordPaddingAttribute.class.st
index 5913e16..9397cf3 100644
--- a/src/Album/AlbTextParagraphWordPaddingAttribute.class.st
+++ b/src/Album/AlbTextParagraphWordPaddingAttribute.class.st
@@ -1,51 +1,49 @@
 Class {
-	#name : 'AlbTextParagraphWordPaddingAttribute',
-	#superclass : 'AlbTextParagraphAttribute',
+	#name : #AlbTextParagraphWordPaddingAttribute,
+	#superclass : #AlbTextParagraphAttribute,
 	#instVars : [
 		'wordPadding'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextParagraphWordPaddingAttribute class >> wordPadding: aBlInsets [
 	^ self new wordPadding: aBlInsets
 ]
 
-{ #category : 'hook' }
+{ #category : #hook }
 AlbTextParagraphWordPaddingAttribute >> applyOn: aTextParagraph [
 	aTextParagraph wordPadding: self wordPadding
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphWordPaddingAttribute >> equals: anAnotherAttribute [
 	^ self wordPadding = anAnotherAttribute wordPadding
 ]
 
-{ #category : 'comparing' }
+{ #category : #comparing }
 AlbTextParagraphWordPaddingAttribute >> hash [
 	"Answer an integer value that is related to the identity of the receiver."
 
 	^ super hash bitXor: self wordPadding hash
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextParagraphWordPaddingAttribute >> initialize [
 	super initialize.
 
 	wordPadding := BlInsets empty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphWordPaddingAttribute >> wordPadding [
 	<return: #BlInsets>
 
 	^ wordPadding
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextParagraphWordPaddingAttribute >> wordPadding: aBlInsets [
 	wordPadding := aBlInsets
 ]
diff --git a/src/Album/AlbTextPortionElement.class.st b/src/Album/AlbTextPortionElement.class.st
index 3747651..174f8b4 100644
--- a/src/Album/AlbTextPortionElement.class.st
+++ b/src/Album/AlbTextPortionElement.class.st
@@ -1,36 +1,34 @@
 Class {
-	#name : 'AlbTextPortionElement',
-	#superclass : 'BlElement',
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#name : #AlbTextPortionElement,
+	#superclass : #BlElement,
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextPortionElement >> borderColor [
 
 	^ Color black
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextPortionElement >> borderWidth [
 
 	^ 1
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextPortionElement >> defaultBackground [ 
 
 	^ Color transparent 
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextPortionElement >> defaultBorder [
 
 	^ BlBorder paint: self borderColor width: self borderWidth
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextPortionElement >> initialize [ 
 
 	super initialize.
diff --git a/src/Album/AlbTextPortionUpdater.class.st b/src/Album/AlbTextPortionUpdater.class.st
index 0a2e1da..f226055 100644
--- a/src/Album/AlbTextPortionUpdater.class.st
+++ b/src/Album/AlbTextPortionUpdater.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbTextPortionUpdater',
-	#superclass : 'Object',
+	#name : #AlbTextPortionUpdater,
+	#superclass : #Object,
 	#instVars : [
 		'cursorMoveHandler',
 		'selectionHandler',
@@ -11,29 +11,27 @@ Class {
 		'infiniteEditorChangeHandler',
 		'portions'
 	],
-	#category : 'Album-UI-Text-Portion',
-	#package : 'Album',
-	#tag : 'UI-Text-Portion'
+	#category : 'Album-UI-Text-Portion'
 }
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> cursorMovedIn: anEditorElement [ 
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> extentChangedIn: anInfiniteElement [
 
 	self updatePortionsIn: anInfiniteElement
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextPortionUpdater >> initialize [ 
 
 	super initialize.
 	portions := OrderedCollection new
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbTextPortionUpdater >> onInstalledIn: anEditorElement [
 
 
@@ -75,7 +73,7 @@ AlbTextPortionUpdater >> onInstalledIn: anEditorElement [
 	anEditorElement infinite addEventHandler: infiniteEditorChangeHandler
 ]
 
-{ #category : 'api - install/uninstall  hook' }
+{ #category : #'api - install/uninstall  hook' }
 AlbTextPortionUpdater >> onUninstalledIn: anEditorElement [
 
 	anEditorElement removeEventHandler: extentChangeHandler.
@@ -88,43 +86,43 @@ AlbTextPortionUpdater >> onUninstalledIn: anEditorElement [
 
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextPortionUpdater >> resetPortionsIn: anEditorElement [
 
 	anEditorElement frontLayer removeChildren: portions.
 	portions reset
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> scrollEventIn: anInfiniteElement [
 
 	self updatePortionsIn: anInfiniteElement
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> selectionChangedIn: anInfiniteElement [
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextPortionUpdater >> setPortionsIn: anEditorElement [
 
 	anEditorElement frontLayer addChildren: portions
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextPortionUpdater >> terminateUpdater [
 
 	updaterProcess ifNotNil: #terminate.
 	updaterProcess := nil
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> textEditedIn: anInfiniteElement [
 
 	self updatePortionsIn: anInfiniteElement
 ]
 
-{ #category : 'infinite element changes' }
+{ #category : #'infinite element changes' }
 AlbTextPortionUpdater >> updatePortionsIn: anEditorElement [
 
 ]
diff --git a/src/Album/AlbTextReplacedEvent.class.st b/src/Album/AlbTextReplacedEvent.class.st
index ed6669b..51909e0 100644
--- a/src/Album/AlbTextReplacedEvent.class.st
+++ b/src/Album/AlbTextReplacedEvent.class.st
@@ -1,25 +1,23 @@
 Class {
-	#name : 'AlbTextReplacedEvent',
-	#superclass : 'BlEvent',
+	#name : #AlbTextReplacedEvent,
+	#superclass : #BlEvent,
 	#instVars : [
 		'text'
 	],
-	#category : 'Album-Model-Events',
-	#package : 'Album',
-	#tag : 'Model-Events'
+	#category : 'Album-Model-Events'
 }
 
-{ #category : 'sending' }
+{ #category : #sending }
 AlbTextReplacedEvent >> sendTo: anEventHandler [
 	anEventHandler textReplacedEvent: self
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacedEvent >> text [
 	^ text
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacedEvent >> text: anObject [
 	text := anObject
 ]
diff --git a/src/Album/AlbTextReplacingAttribute.class.st b/src/Album/AlbTextReplacingAttribute.class.st
index 491c6af..15eea16 100644
--- a/src/Album/AlbTextReplacingAttribute.class.st
+++ b/src/Album/AlbTextReplacingAttribute.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbTextReplacingAttribute',
-	#superclass : 'AlbTextAdornmentAttribute',
+	#name : #AlbTextReplacingAttribute,
+	#superclass : #AlbTextAdornmentAttribute,
 	#instVars : [
 		'replacement',
 		'embellishment',
@@ -9,12 +9,10 @@ Class {
 		'originalString',
 		'replacementString'
 	],
-	#category : 'Album-Attributes',
-	#package : 'Album',
-	#tag : 'Attributes'
+	#category : 'Album-Attributes'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElement [
 	"Return an element that should affect (either append or replace) a provided text piece"
 	<return: #SequenceableCollection of: #BlElement>
@@ -40,17 +38,17 @@ AlbTextReplacingAttribute >> doAffect: aTTextEditorTextualPiece in: anEditorElem
 	}
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> embellishment [
 	^ embellishment
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> embellishment: anObject [
 	embellishment := anObject
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextReplacingAttribute >> initialize [
 	super initialize.
 	
@@ -60,29 +58,29 @@ AlbTextReplacingAttribute >> initialize [
 	margin := BlInsets empty
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttribute >> margin [
 	^ margin
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttribute >> margin: anObject [
 	margin := anObject
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> padding [
 	<return: #BlInsets>
 
 	^ padding
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> padding: anObject [
 	padding := anObject
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextReplacingAttribute >> replaceTextInPiece: aTTextEditorTextualPiece [
 	| aNewText anOriginalText |
 	
@@ -99,19 +97,19 @@ AlbTextReplacingAttribute >> replaceTextInPiece: aTTextEditorTextualPiece [
 	^ aTTextEditorTextualPiece copyWithText: aNewText
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttribute >> replacement [
 	<return: #AlbTextReplacingAttributeStrategy>
 
 	^ replacement
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttribute >> replacement: aTextReplacingAttributeStrategy [
 	replacement := aTextReplacingAttributeStrategy
 ]
 
-{ #category : 'private' }
+{ #category : #private }
 AlbTextReplacingAttribute >> swapString: aString [
 	<return: #String>
 	
@@ -124,12 +122,12 @@ AlbTextReplacingAttribute >> swapString: aString [
 	^ replacementString
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> withCharacter: aCharacter [
 	self replacement: (AlbTextReplacingAttributeWithCharacterStrategy new character: aCharacter)
 ]
 
-{ #category : 'api - attribute' }
+{ #category : #'api - attribute' }
 AlbTextReplacingAttribute >> withRandomizing [
 	self replacement: (AlbTextReplacingAttributeWithRandomizingStrategy new)
 ]
diff --git a/src/Album/AlbTextReplacingAttributeStrategy.class.st b/src/Album/AlbTextReplacingAttributeStrategy.class.st
index f293d61..bdcad20 100644
--- a/src/Album/AlbTextReplacingAttributeStrategy.class.st
+++ b/src/Album/AlbTextReplacingAttributeStrategy.class.st
@@ -1,12 +1,10 @@
 Class {
-	#name : 'AlbTextReplacingAttributeStrategy',
-	#superclass : 'Object',
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#name : #AlbTextReplacingAttributeStrategy,
+	#superclass : #Object,
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'replacing' }
+{ #category : #replacing }
 AlbTextReplacingAttributeStrategy >> swapString: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextReplacingAttributeWithCharacterStrategy.class.st b/src/Album/AlbTextReplacingAttributeWithCharacterStrategy.class.st
index 13c129e..822cbb2 100644
--- a/src/Album/AlbTextReplacingAttributeWithCharacterStrategy.class.st
+++ b/src/Album/AlbTextReplacingAttributeWithCharacterStrategy.class.st
@@ -1,32 +1,30 @@
 Class {
-	#name : 'AlbTextReplacingAttributeWithCharacterStrategy',
-	#superclass : 'AlbTextReplacingAttributeStrategy',
+	#name : #AlbTextReplacingAttributeWithCharacterStrategy,
+	#superclass : #AlbTextReplacingAttributeStrategy,
 	#instVars : [
 		'character'
 	],
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttributeWithCharacterStrategy >> character [
 	^ character
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttributeWithCharacterStrategy >> character: anObject [
 	character := anObject
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextReplacingAttributeWithCharacterStrategy >> initialize [
 	super initialize.
 	
 	character := $*
 ]
 
-{ #category : 'replacing' }
+{ #category : #replacing }
 AlbTextReplacingAttributeWithCharacterStrategy >> swapString: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextReplacingAttributeWithRandomizingStrategy.class.st b/src/Album/AlbTextReplacingAttributeWithRandomizingStrategy.class.st
index 5b73fc4..6b6055b 100644
--- a/src/Album/AlbTextReplacingAttributeWithRandomizingStrategy.class.st
+++ b/src/Album/AlbTextReplacingAttributeWithRandomizingStrategy.class.st
@@ -1,15 +1,13 @@
 Class {
-	#name : 'AlbTextReplacingAttributeWithRandomizingStrategy',
-	#superclass : 'AlbTextReplacingAttributeStrategy',
+	#name : #AlbTextReplacingAttributeWithRandomizingStrategy,
+	#superclass : #AlbTextReplacingAttributeStrategy,
 	#instVars : [
 		'special'
 	],
-	#category : 'Album-Attributes - Support',
-	#package : 'Album',
-	#tag : 'Attributes - Support'
+	#category : 'Album-Attributes - Support'
 }
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextReplacingAttributeWithRandomizingStrategy >> initialize [
 	super initialize.
 	
@@ -20,7 +18,7 @@ AlbTextReplacingAttributeWithRandomizingStrategy >> initialize [
 		   with: Character times))
 ]
 
-{ #category : 'replacing' }
+{ #category : #replacing }
 AlbTextReplacingAttributeWithRandomizingStrategy >> replaceCharacter: aCharacter [
 
 	aCharacter isDigit
@@ -37,17 +35,17 @@ AlbTextReplacingAttributeWithRandomizingStrategy >> replaceCharacter: aCharacter
 	^ aCharacter
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttributeWithRandomizingStrategy >> special [
 	^ special
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextReplacingAttributeWithRandomizingStrategy >> special: anObject [
 	special := anObject
 ]
 
-{ #category : 'replacing' }
+{ #category : #replacing }
 AlbTextReplacingAttributeWithRandomizingStrategy >> swapString: aString [
 	<return: #String>
 	
diff --git a/src/Album/AlbTextWordPieceBlurHandler.class.st b/src/Album/AlbTextWordPieceBlurHandler.class.st
index 61a1047..24e6521 100644
--- a/src/Album/AlbTextWordPieceBlurHandler.class.st
+++ b/src/Album/AlbTextWordPieceBlurHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceBlurHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceBlurHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceBlurHandler >> eventClass [
 	^ AlbTextEditorBlurRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceBlurHandler >> handleEvent: anEvent [
 	anEvent currentTarget hideCursor
 ]
diff --git a/src/Album/AlbTextWordPieceDeselectionHandler.class.st b/src/Album/AlbTextWordPieceDeselectionHandler.class.st
index e9778cf..b2e9c3b 100644
--- a/src/Album/AlbTextWordPieceDeselectionHandler.class.st
+++ b/src/Album/AlbTextWordPieceDeselectionHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceDeselectionHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceDeselectionHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceDeselectionHandler >> eventClass [
 	^ AlbTextEditorDeselectRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceDeselectionHandler >> handleEvent: anEvent [
 	anEvent currentTarget selectNone
 ]
diff --git a/src/Album/AlbTextWordPieceFocusHandler.class.st b/src/Album/AlbTextWordPieceFocusHandler.class.st
index 40cc66f..6980783 100644
--- a/src/Album/AlbTextWordPieceFocusHandler.class.st
+++ b/src/Album/AlbTextWordPieceFocusHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceFocusHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceFocusHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceFocusHandler >> eventClass [
 	^ AlbTextEditorFocusRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceFocusHandler >> handleEvent: anEvent [
 	anEvent currentTarget showCursor
 ]
diff --git a/src/Album/AlbTextWordPieceHandler.class.st b/src/Album/AlbTextWordPieceHandler.class.st
index 02306ba..0879dce 100644
--- a/src/Album/AlbTextWordPieceHandler.class.st
+++ b/src/Album/AlbTextWordPieceHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceHandler',
-	#superclass : 'BlBasicEventHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceHandler,
+	#superclass : #BlBasicEventHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceHandler >> eventClass [
 	^ self subclassResponsibility
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceHandler >> globalTextIndexToLocal: aTextIndex in: aTextEditElement [
 	"Convert global text index given in the text coordinates of the whole editor to a local index within this segment piece.
 	This convertion is necessary due to the fact that text elements that represent every segment piece work with text in their own local system"
@@ -20,12 +18,12 @@ AlbTextWordPieceHandler >> globalTextIndexToLocal: aTextIndex in: aTextEditEleme
 	^ aTextIndex + aTextEditElement textStart
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceHandler >> handleEvent: anEvent [
 	self subclassResponsibility
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceHandler >> localTextIndexToGlobal: aTextIndex in: aTextEditElement [
 	"Convert local text index given in the text coordinates of the given text piece to a global index within the whole text editor.
 	This convertion is necessary due to the fact that text elements that represent every segment piece work with text in their own local system"
@@ -34,7 +32,7 @@ AlbTextWordPieceHandler >> localTextIndexToGlobal: aTextIndex in: aTextEditEleme
 	^ aTextEditElement textStart + aTextIndex
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceHandler >> wantsEvent: anEvent [
 	^ anEvent class = self eventClass or: [ anEvent class inheritsFrom: self eventClass ]
 ]
diff --git a/src/Album/AlbTextWordPieceHideCursorHandler.class.st b/src/Album/AlbTextWordPieceHideCursorHandler.class.st
index 4b4530d..ef98185 100644
--- a/src/Album/AlbTextWordPieceHideCursorHandler.class.st
+++ b/src/Album/AlbTextWordPieceHideCursorHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceHideCursorHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceHideCursorHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceHideCursorHandler >> eventClass [
 	^ AlbTextEditorHideCursorRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceHideCursorHandler >> handleEvent: anEvent [
 	| aTextElement aCursorElement |
 	
diff --git a/src/Album/AlbTextWordPieceScreenToCursorHandler.class.st b/src/Album/AlbTextWordPieceScreenToCursorHandler.class.st
index 1ff813d..9cd63d7 100644
--- a/src/Album/AlbTextWordPieceScreenToCursorHandler.class.st
+++ b/src/Album/AlbTextWordPieceScreenToCursorHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceScreenToCursorHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceScreenToCursorHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceScreenToCursorHandler >> eventClass [
 	^ AlbTextEditorScreenToCursorRequest
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbTextWordPieceScreenToCursorHandler >> explicitScreenToCursor: aTransformation for: anEvent [
 	| aLocalPosition aLocalTextIndex aGobaltextIndex |
 		
@@ -22,7 +20,7 @@ AlbTextWordPieceScreenToCursorHandler >> explicitScreenToCursor: aTransformation
 	aTransformation transformed: aGobaltextIndex
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceScreenToCursorHandler >> handleEvent: anEvent [
 
 	| aTextElement |
@@ -33,7 +31,7 @@ AlbTextWordPieceScreenToCursorHandler >> handleEvent: anEvent [
 	anEvent transformation evaluateOn: self for: anEvent
 ]
 
-{ #category : 'geometry' }
+{ #category : #geometry }
 AlbTextWordPieceScreenToCursorHandler >> relativeScreenToCursor: aTransformation for: anEvent [
 	"I do the hard work of finding a text element above or below a cursor that should be moved up or down and transfer cursor inside of it
 	based on the current location of the cursor or on desired coordinate within the text editor"
diff --git a/src/Album/AlbTextWordPieceSelectionAcquiredHandler.class.st b/src/Album/AlbTextWordPieceSelectionAcquiredHandler.class.st
index eb3913a..cfe7892 100644
--- a/src/Album/AlbTextWordPieceSelectionAcquiredHandler.class.st
+++ b/src/Album/AlbTextWordPieceSelectionAcquiredHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceSelectionAcquiredHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceSelectionAcquiredHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceSelectionAcquiredHandler >> eventClass [
 	^ BlElementSelectionAcquiredEvent
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceSelectionAcquiredHandler >> handleEvent: anEvent [
 	| anEditorElement aTextElement aGlobalFrom aGlobalTo |
 
diff --git a/src/Album/AlbTextWordPieceSelectionHandler.class.st b/src/Album/AlbTextWordPieceSelectionHandler.class.st
index 5bb9e42..a3b177b 100644
--- a/src/Album/AlbTextWordPieceSelectionHandler.class.st
+++ b/src/Album/AlbTextWordPieceSelectionHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceSelectionHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceSelectionHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceSelectionHandler >> eventClass [
 	^ AlbTextEditorSelectRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceSelectionHandler >> handleEvent: anEvent [
 	anEvent currentTarget select: anEvent fromIndex to: anEvent toIndex
 ]
diff --git a/src/Album/AlbTextWordPieceSelectionLostHandler.class.st b/src/Album/AlbTextWordPieceSelectionLostHandler.class.st
index fa0c7bb..cd9226e 100644
--- a/src/Album/AlbTextWordPieceSelectionLostHandler.class.st
+++ b/src/Album/AlbTextWordPieceSelectionLostHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceSelectionLostHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceSelectionLostHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceSelectionLostHandler >> eventClass [
 	^ BlElementSelectionLostEvent
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceSelectionLostHandler >> handleEvent: anEvent [
 	| aTextEditElement anEditorElement |
 	
diff --git a/src/Album/AlbTextWordPieceShowCursorHandler.class.st b/src/Album/AlbTextWordPieceShowCursorHandler.class.st
index 7bb1c22..f705e7c 100644
--- a/src/Album/AlbTextWordPieceShowCursorHandler.class.st
+++ b/src/Album/AlbTextWordPieceShowCursorHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceShowCursorHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceShowCursorHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceShowCursorHandler >> eventClass [
 	^ AlbTextEditorShowCursorRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceShowCursorHandler >> handleEvent: anEvent [
 
 	| aCursorElement |
diff --git a/src/Album/AlbTextWordPieceStencil.class.st b/src/Album/AlbTextWordPieceStencil.class.st
index 8852684..dbe279c 100644
--- a/src/Album/AlbTextWordPieceStencil.class.st
+++ b/src/Album/AlbTextWordPieceStencil.class.st
@@ -1,6 +1,6 @@
 Class {
-	#name : 'AlbTextWordPieceStencil',
-	#superclass : 'BlStencil',
+	#name : #AlbTextWordPieceStencil,
+	#superclass : #BlStencil,
 	#instVars : [
 		'wordPadding',
 		'wordMargin',
@@ -8,24 +8,22 @@ Class {
 		'readOnly',
 		'measurer'
 	],
-	#category : 'Album-UI-Stencils',
-	#package : 'Album',
-	#tag : 'UI-Stencils'
+	#category : 'Album-UI-Stencils'
 }
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextWordPieceStencil class >> editable [
 
 	^ self new beEditable
 ]
 
-{ #category : 'instance creation' }
+{ #category : #'instance creation' }
 AlbTextWordPieceStencil class >> readOnly [
 
 	^ self new beReadOnly
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> allEventHandlers [
 
 	^ readOnly
@@ -33,19 +31,19 @@ AlbTextWordPieceStencil >> allEventHandlers [
 		  ifFalse: [ self editableWordPieceEventHandlers ]
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> beEditable [
 
 	readOnly := false
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> beReadOnly [ 
 
 	readOnly := true
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> create [
 
 	| aTextElement |
@@ -58,7 +56,7 @@ AlbTextWordPieceStencil >> create [
 	^ aTextElement
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> createWordElement [
 
 	<return: #AlbTextElements>
@@ -70,7 +68,7 @@ AlbTextWordPieceStencil >> createWordElement [
 	^ wordElement
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> editableWordPieceEventHandlers [
 
 	^ {  "to support event-handling attributes"
@@ -106,27 +104,27 @@ AlbTextWordPieceStencil >> editableWordPieceEventHandlers [
 	
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextWordPieceStencil >> initialize [
 	super initialize.
 	readOnly := false.	
 	self reset
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> measurer [
 	<return: #BlTextElementMeasurer>
 
 	^ measurer
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> measurer: aBlTextElementMeasurer [
 
 	measurer := aBlTextElementMeasurer
 ]
 
-{ #category : 'api - instantiation' }
+{ #category : #'api - instantiation' }
 AlbTextWordPieceStencil >> readOnlyWordPieceEventHandlers [
 
 	^ {  "to support event-handling attributes"
@@ -156,45 +154,45 @@ AlbTextWordPieceStencil >> readOnlyWordPieceEventHandlers [
 	
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 AlbTextWordPieceStencil >> reset [
 	wordPadding := BlInsets empty.
 	wordMargin := BlInsets empty.
 	segmentPiece := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> segmentPiece [
 	<return: #TAlbTextEditorTextualPiece>
 
 	^ segmentPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> segmentPiece: aTAlbTextEditorTextualPiece [
 	segmentPiece := aTAlbTextEditorTextualPiece
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> wordMargin [
 	<return: #BlInsets>
 
 	^ wordMargin
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> wordMargin: aBlInsets [
 	wordMargin := aBlInsets
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> wordPadding [
 	<return: #BlInsets>
 
 	^ wordPadding
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceStencil >> wordPadding: aBlInsets [
 	wordPadding := aBlInsets
 ]
diff --git a/src/Album/AlbTextWordPieceTextChangeHandler.class.st b/src/Album/AlbTextWordPieceTextChangeHandler.class.st
index 0c42c44..dd3294b 100644
--- a/src/Album/AlbTextWordPieceTextChangeHandler.class.st
+++ b/src/Album/AlbTextWordPieceTextChangeHandler.class.st
@@ -1,17 +1,15 @@
 Class {
-	#name : 'AlbTextWordPieceTextChangeHandler',
-	#superclass : 'AlbTextWordPieceUniqueHandler',
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#name : #AlbTextWordPieceTextChangeHandler,
+	#superclass : #AlbTextWordPieceUniqueHandler,
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceTextChangeHandler >> eventClass [
 	^ AlbTextEditorTextChangedRequest
 ]
 
-{ #category : 'api - event managing' }
+{ #category : #'api - event managing' }
 AlbTextWordPieceTextChangeHandler >> handleEvent: anEvent [
 	anEvent currentTarget segmentPiece: anEvent segmentPiece.
 	
diff --git a/src/Album/AlbTextWordPieceUniqueHandler.class.st b/src/Album/AlbTextWordPieceUniqueHandler.class.st
index 691c137..a226ea8 100644
--- a/src/Album/AlbTextWordPieceUniqueHandler.class.st
+++ b/src/Album/AlbTextWordPieceUniqueHandler.class.st
@@ -1,22 +1,20 @@
 Class {
-	#name : 'AlbTextWordPieceUniqueHandler',
-	#superclass : 'AlbTextWordPieceHandler',
+	#name : #AlbTextWordPieceUniqueHandler,
+	#superclass : #AlbTextWordPieceHandler,
 	#classInstVars : [
 		'uniqueInstance'
 	],
-	#category : 'Album-UI-Word',
-	#package : 'Album',
-	#tag : 'UI-Word'
+	#category : 'Album-UI-Word'
 }
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceUniqueHandler class >> cleanUp [
 	super cleanUp.
 	
 	uniqueInstance := nil
 ]
 
-{ #category : 'accessing' }
+{ #category : #accessing }
 AlbTextWordPieceUniqueHandler class >> uniqueInstance [
 	^ uniqueInstance ifNil: [ uniqueInstance := self new ]
 ]
diff --git a/src/Album/BlLayoutCommonConstraints.extension.st b/src/Album/BlLayoutCommonConstraints.extension.st
index 05f8d2e..a24768e 100644
--- a/src/Album/BlLayoutCommonConstraints.extension.st
+++ b/src/Album/BlLayoutCommonConstraints.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'BlLayoutCommonConstraints' }
+Extension { #name : #BlLayoutCommonConstraints }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 BlLayoutCommonConstraints >> albumTextFlow [
 	^ self at: AlbLineFlowLayout
 ]
diff --git a/src/Album/BlLayoutCommonConstraintsAxis.extension.st b/src/Album/BlLayoutCommonConstraintsAxis.extension.st
index 3dedf91..7c090b9 100644
--- a/src/Album/BlLayoutCommonConstraintsAxis.extension.st
+++ b/src/Album/BlLayoutCommonConstraintsAxis.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'BlLayoutCommonConstraintsAxis' }
+Extension { #name : #BlLayoutCommonConstraintsAxis }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 BlLayoutCommonConstraintsAxis >> albumTextFlow [
 	^ self at: AlbLineFlowLayout
 ]
diff --git a/src/Album/BlText.extension.st b/src/Album/BlText.extension.st
index 839c425..e84618f 100644
--- a/src/Album/BlText.extension.st
+++ b/src/Album/BlText.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'BlText' }
+Extension { #name : #BlText }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 BlText >> onAlbum [
 	^ AlbEditorElement new text: self 
 ]
diff --git a/src/Album/BlTextElement.extension.st b/src/Album/BlTextElement.extension.st
index dd8cf1a..dfc7cbb 100644
--- a/src/Album/BlTextElement.extension.st
+++ b/src/Album/BlTextElement.extension.st
@@ -1,11 +1,11 @@
-Extension { #name : 'BlTextElement' }
+Extension { #name : #BlTextElement }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 BlTextElement >> positionInEditor [
 	^ self constraints albumTextFlow positionInEditor
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 BlTextElement >> positionInEditor: aPoint [
 	self constraints albumTextFlow positionInEditor: aPoint
 ]
diff --git a/src/Album/FreeTypeFont.extension.st b/src/Album/FreeTypeFont.extension.st
index d9ce3af..c5b84ae 100644
--- a/src/Album/FreeTypeFont.extension.st
+++ b/src/Album/FreeTypeFont.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'FreeTypeFont' }
+Extension { #name : #FreeTypeFont }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 FreeTypeFont >> averageWidthOf: aCharacter [
 	^ self linearWidthOf: aCharacter
 ]
diff --git a/src/Album/LimitedWriteStream.extension.st b/src/Album/LimitedWriteStream.extension.st
index 8c40208..f4b4151 100644
--- a/src/Album/LimitedWriteStream.extension.st
+++ b/src/Album/LimitedWriteStream.extension.st
@@ -1,16 +1,16 @@
-Extension { #name : 'LimitedWriteStream' }
+Extension { #name : #LimitedWriteStream }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 LimitedWriteStream >> segments [
 	^ self contents
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 LimitedWriteStream >> unlimited [
 	self limit: Float infinity 
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 LimitedWriteStream >> wantsMore [
 	^ self size < self limit
 ]
diff --git a/src/Album/ManifestAlbum.class.st b/src/Album/ManifestAlbum.class.st
index ddc6cb7..2005f3d 100644
--- a/src/Album/ManifestAlbum.class.st
+++ b/src/Album/ManifestAlbum.class.st
@@ -2,14 +2,12 @@
 Please describe the package using the class comment of the included manifest class. The manifest class also includes other additional metadata for the package. These meta data are used by other tools such as the SmalllintManifestChecker and the critics Browser
 "
 Class {
-	#name : 'ManifestAlbum',
-	#superclass : 'PackageManifest',
-	#category : 'Album-Manifest',
-	#package : 'Album',
-	#tag : 'Manifest'
+	#name : #ManifestAlbum,
+	#superclass : #PackageManifest,
+	#category : 'Album-Manifest'
 }
 
-{ #category : 'code-critics' }
+{ #category : #'code-critics' }
 ManifestAlbum class >> ruleAnySatisfyRuleV1FalsePositive [
 	^ #(#(#(#RGMethodDefinition #(#BlInfinteSideDecoration #selectionLimitRectangleOf:in: #false)) #'2022-08-30T23:11:35.989869+02:00') )
 ]
diff --git a/src/Album/String.extension.st b/src/Album/String.extension.st
index c4b10c7..7b758d1 100644
--- a/src/Album/String.extension.st
+++ b/src/Album/String.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'String' }
+Extension { #name : #String }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 String >> onAlbum [
 	^ AlbEditorElement new text: self 
 ]
diff --git a/src/Album/TAlbInfiniteDecorator.trait.st b/src/Album/TAlbInfiniteDecorator.trait.st
index f49e640..8c33cd7 100644
--- a/src/Album/TAlbInfiniteDecorator.trait.st
+++ b/src/Album/TAlbInfiniteDecorator.trait.st
@@ -1,152 +1,150 @@
 Trait {
-	#name : 'TAlbInfiniteDecorator',
+	#name : #TAlbInfiniteDecorator,
 	#instVars : [
 		'next'
 	],
-	#category : 'Album-UI',
-	#package : 'Album',
-	#tag : 'UI'
+	#category : 'Album-UI'
 }
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> addEditorShortcut: aTextEditorInteraction [
 
 	self next addEditorShortcut: aTextEditorInteraction
 ]
 
-{ #category : 't - infinite editor converting' }
+{ #category : #'t - infinite editor converting' }
 TAlbInfiniteDecorator >> asScrollableElement [
 
 	^ self next asScrollableElement
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> beEditable [
 
 	self next beEditable
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> beReadonlyWithSelection [
 
 	self next beReadonlyWithSelection
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> beReadonlyWithoutSelection [
 
 	self next beReadonlyWithoutSelection
 ]
 
-{ #category : 't - infinite editor private - accessing editor' }
+{ #category : #'t - infinite editor private - accessing editor' }
 TAlbInfiniteDecorator >> cacheSize: aNumber [
 
 	self next cacheSize: aNumber
 ]
 
-{ #category : 't - infinite editor accessing - cursor' }
+{ #category : #'t - infinite editor accessing - cursor' }
 TAlbInfiniteDecorator >> cursor [
 
 	^ self next cursor
 ]
 
-{ #category : 't - infinite editor accessing - cursor' }
+{ #category : #'t - infinite editor accessing - cursor' }
 TAlbInfiniteDecorator >> cursorColor: aColor [
 
 	self next cursorColor: aColor
 ]
 
-{ #category : 't - infinite editor accessing - cursor' }
+{ #category : #'t - infinite editor accessing - cursor' }
 TAlbInfiniteDecorator >> cursors [
 	<return: #AlbTextEditorCursor>
 	
 	^ self next cursors
 ]
 
-{ #category : 't - infinite editor editor - operator' }
+{ #category : #'t - infinite editor editor - operator' }
 TAlbInfiniteDecorator >> deleter [
 	<return: #AlbTextEditorDeleter>
 
 	^ self next deleter
 ]
 
-{ #category : 't - infinite editor editor - operator' }
+{ #category : #'t - infinite editor editor - operator' }
 TAlbInfiniteDecorator >> deselecter [
 	<return: #AlbTextEditorDeselecter>
 
 	^ self next deselecter
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> editor [
 	<return: #AlbTextEditor>
 
 	^ self next editor
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> editor: aTextEditor [
 
 	self next editor: aTextEditor.
 
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> editorDo: aBlock [
 
 	self next editorDo: aBlock
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> enlargedSubTextOnScreen [
 	
 	^ self next enlargedSubTextOnScreen 
 ]
 
-{ #category : 't - infinite editor focus testing' }
+{ #category : #'t - infinite editor focus testing' }
 TAlbInfiniteDecorator >> hasFocus [
 
 	^ self next hasFocus
 ]
 
-{ #category : 't - infinite editor accessing - selection' }
+{ #category : #'t - infinite editor accessing - selection' }
 TAlbInfiniteDecorator >> hasSelection [
 
 	^ self next hasSelection
 ]
 
-{ #category : 't - infinite editor accessing' }
+{ #category : #'t - infinite editor accessing' }
 TAlbInfiniteDecorator >> infinite [
 
 	^ self next infinite
 ]
 
-{ #category : 't - infinite editor accessing' }
+{ #category : #'t - infinite editor accessing' }
 TAlbInfiniteDecorator >> infiniteDo: aBlock [
 
 	aBlock value: self infinite
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> inputFilter: aTextEditorInputFilter [
 
 	self next inputFilter: aTextEditorInputFilter
 ]
 
-{ #category : 't - infinite editor editor - operator' }
+{ #category : #'t - infinite editor editor - operator' }
 TAlbInfiniteDecorator >> inserter [
 	<return: #AlbTextEditorInserter>
 
 	^ self next inserter
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> isEditable [
 
 	^ self next isEditable
 ]
 
-{ #category : 't - infinite editor accessing - mode' }
+{ #category : #'t - infinite editor accessing - mode' }
 TAlbInfiniteDecorator >> mode [
 
 	<return: #BlText>
@@ -154,100 +152,100 @@ TAlbInfiniteDecorator >> mode [
 	^ self next mode
 ]
 
-{ #category : 't - infinite editor accessing - mode' }
+{ #category : #'t - infinite editor accessing - mode' }
 TAlbInfiniteDecorator >> mode: anEditabilityMode [
 
 	self next mode: anEditabilityMode
 ]
 
-{ #category : 't - infinite editor editor - operator' }
+{ #category : #'t - infinite editor editor - operator' }
 TAlbInfiniteDecorator >> navigator [
 	<return: #AlbTextEditorNavigator>
 
 	^ self next navigator
 ]
 
-{ #category : 't - infinite editor accessing' }
+{ #category : #'t - infinite editor accessing' }
 TAlbInfiniteDecorator >> next [
 
 	^ next
 ]
 
-{ #category : 't - infinite editor accessing' }
+{ #category : #'t - infinite editor accessing' }
 TAlbInfiniteDecorator >> next: aDecoratorOrInfinite [
 
 	next := aDecoratorOrInfinite
 ]
 
-{ #category : 't - infinite editor focus accessing' }
+{ #category : #'t - infinite editor focus accessing' }
 TAlbInfiniteDecorator >> onGotFocus [
 
 	self next onGotFocus
 ]
 
-{ #category : 't - infinite editor focus accessing' }
+{ #category : #'t - infinite editor focus accessing' }
 TAlbInfiniteDecorator >> onLostFocus [
 
 	self next onLostFocus.
 
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> removeEditorShortcut: aTextEditorInteraction [
 
 	self next removeEditorShortcut: aTextEditorInteraction
 ]
 
-{ #category : 't - infinite editor steps - interactions' }
+{ #category : #'t - infinite editor steps - interactions' }
 TAlbInfiniteDecorator >> requestFocus [
 
 	self next requestFocus
 ]
 
-{ #category : 't - infinite editor private - accessing editor' }
+{ #category : #'t - infinite editor private - accessing editor' }
 TAlbInfiniteDecorator >> segments [
 	^ self next segments
 ]
 
-{ #category : 't - infinite editor accessing - selection' }
+{ #category : #'t - infinite editor accessing - selection' }
 TAlbInfiniteDecorator >> selectedText [
 
 	^ self next selectedText
 ]
 
-{ #category : 't - infinite editor editor - operator' }
+{ #category : #'t - infinite editor editor - operator' }
 TAlbInfiniteDecorator >> selecter [
 	<return: #AlbTextEditorSelecter>
 
 	^ self next selecter
 ]
 
-{ #category : 't - infinite editor accessing - selection' }
+{ #category : #'t - infinite editor accessing - selection' }
 TAlbInfiniteDecorator >> selection [
 	<return: #BlSelection>
 
 	^ self next selection
 ]
 
-{ #category : 't - infinite editor accessing - selection' }
+{ #category : #'t - infinite editor accessing - selection' }
 TAlbInfiniteDecorator >> selectionColor [
 
 	^ self next selectionColor
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> subTextOnScreen [
 	
 	^ self next subTextOnScreen 
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> subTextOnScreenInterval [
 	
 	^ self next subTextOnScreenInterval 
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> text [
 	"Return a text I work with. All modifications to a text must be done from UI thread"
 	<return: #BlText>
@@ -255,37 +253,37 @@ TAlbInfiniteDecorator >> text [
 	^ self next text
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> text: aText [
 
 	self next text: aText
 ]
 
-{ #category : 't - infinite editor private - view accessing' }
+{ #category : #'t - infinite editor private - view accessing' }
 TAlbInfiniteDecorator >> textElementsDo: aBlock [
 
 	self next textElementsDo: aBlock
 ]
 
-{ #category : 't - infinite editor private - accessing text' }
+{ #category : #'t - infinite editor private - accessing text' }
 TAlbInfiniteDecorator >> textInternalRepresentationChanged [
 
 	self next textInternalRepresentationChanged
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> textLeft [
 
 	^  self padding left + self next textLeft
 ]
 
-{ #category : 't - infinite editor private - accessing text' }
+{ #category : #'t - infinite editor private - accessing text' }
 TAlbInfiniteDecorator >> textPiecesAndTheirElementsWithinIndexInterval: anInterval do: aBlock [
 
 	self next textPiecesAndTheirElementsWithinIndexInterval: anInterval do: aBlock
 ]
 
-{ #category : 't - infinite editor accessing - text' }
+{ #category : #'t - infinite editor accessing - text' }
 TAlbInfiniteDecorator >> textSnapshot [
 	"Return a snaphost (copy) of the current text.
 	I am safe to use from a non-UI thread because the returned text is independent from the
@@ -295,13 +293,13 @@ TAlbInfiniteDecorator >> textSnapshot [
 	^ self next textSnapshot
 ]
 
-{ #category : 't - infinite editor accessing - editor' }
+{ #category : #'t - infinite editor accessing - editor' }
 TAlbInfiniteDecorator >> whenEditorChangedDo: aBlock [
 
 	self next whenEditorChangedDo: aBlock
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> whenModeChangedDo: aBlock [
 
 	"set a block to perform after that the mode has been chanbed, and its action performed"
@@ -309,56 +307,56 @@ TAlbInfiniteDecorator >> whenModeChangedDo: aBlock [
 	self next whenModeChangedDo: aBlock
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> whenTextEditedDo: aBlock [
 
 	self deprecated: 'Use directly editorDo: [:ed | ed when: AlbTextEditedEvent do: ] instead'. 
 	self next whenTextEditedDo: aBlock
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> whenTextReplacedDo: aBlock [
 
 	self next whenTextReplacedDo: aBlock
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> withRowNumbers [
 
 	self next withRowNumbers
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> withSoftLine [
 
 	self next withSoftLine
 ]
 
-{ #category : 't - infinite editor accessing' }
+{ #category : #'t - infinite editor accessing' }
 TAlbInfiniteDecorator >> withoutCacheLimit [
 
 	self next withoutCacheLimit
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> withoutRowNumbers [
 
 	self next withoutRowNumbers
 ]
 
-{ #category : 't - infinite editor view - configuration' }
+{ #category : #'t - infinite editor view - configuration' }
 TAlbInfiniteDecorator >> withoutSoftLine [
 
 	self next withoutSoftLine
 ]
 
-{ #category : 't - infinite editor private - view accessing' }
+{ #category : #'t - infinite editor private - view accessing' }
 TAlbInfiniteDecorator >> wordStencil [
 
 	^ self next wordStencil
 ]
 
-{ #category : 't - infinite editor private - view accessing' }
+{ #category : #'t - infinite editor private - view accessing' }
 TAlbInfiniteDecorator >> wordStencil: aWordStencil [
 
 	self next wordStencil: aWordStencil
diff --git a/src/Album/TAlbTextEditorTextualPiece.trait.st b/src/Album/TAlbTextEditorTextualPiece.trait.st
index 1758823..69cfb36 100644
--- a/src/Album/TAlbTextEditorTextualPiece.trait.st
+++ b/src/Album/TAlbTextEditorTextualPiece.trait.st
@@ -1,17 +1,15 @@
 Trait {
-	#name : 'TAlbTextEditorTextualPiece',
+	#name : #TAlbTextEditorTextualPiece,
 	#instVars : [
 		'text',
 		'textStart',
 		'textEnd',
 		'delimiterLength'
 	],
-	#category : 'Album-Model-Segment-Text',
-	#package : 'Album',
-	#tag : 'Model-Segment-Text'
+	#category : 'Album-Model-Segment-Text'
 }
 
-{ #category : 'text - copying' }
+{ #category : #'text - copying' }
 TAlbTextEditorTextualPiece >> copyWithText: aBlText [
 	^ self copy
 		initializeWith: aBlText
@@ -20,12 +18,12 @@ TAlbTextEditorTextualPiece >> copyWithText: aBlText [
 		delimiter: delimiterLength
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> delimiterLength [
 	^ delimiterLength
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 TAlbTextEditorTextualPiece >> initializeWith: aBlText from: aTextStart to: aTextEnd [
 	self
 		initializeWith: aBlText
@@ -34,7 +32,7 @@ TAlbTextEditorTextualPiece >> initializeWith: aBlText from: aTextStart to: aText
 		delimiter: 0
 ]
 
-{ #category : 'initialization' }
+{ #category : #initialization }
 TAlbTextEditorTextualPiece >> initializeWith: aBlText from: aTextStart to: aTextEnd delimiter: aDelimiterLength [
 	text := aBlText.
 	
@@ -43,7 +41,7 @@ TAlbTextEditorTextualPiece >> initializeWith: aBlText from: aTextStart to: aText
 	delimiterLength := aDelimiterLength
 ]
 
-{ #category : 'text - testing' }
+{ #category : #'text - testing' }
 TAlbTextEditorTextualPiece >> isEmpty [
 	"Return true if my text is empty, false otherwise"
 	<return: #Boolean>
@@ -51,12 +49,12 @@ TAlbTextEditorTextualPiece >> isEmpty [
 	^ self textLength isZero
 ]
 
-{ #category : 'text - modifications' }
+{ #category : #'text - modifications' }
 TAlbTextEditorTextualPiece >> scopeText: aStartIndex end: anEndIndex [
 	self start: aStartIndex end: anEndIndex
 ]
 
-{ #category : 'private - text' }
+{ #category : #'private - text' }
 TAlbTextEditorTextualPiece >> start: aStartIndex end: anEndIndex [
 	"aStartIndex and anEndIndex are given in cursor coordinates"
 	| aDelta |
@@ -76,7 +74,7 @@ TAlbTextEditorTextualPiece >> start: aStartIndex end: anEndIndex [
 	textEnd := anEndIndex
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> text [
 	"Return a sub-text that I represent"
 	<return: #BlSubText>
@@ -84,7 +82,7 @@ TAlbTextEditorTextualPiece >> text [
 	^ text
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> textEnd [
 	"Return an index of the last character of a subtext that I represent"
 	<return: #Number>
@@ -92,7 +90,7 @@ TAlbTextEditorTextualPiece >> textEnd [
 	^ textEnd
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> textEndDelimited [
 	"Return an index of the last character of a subtext that I represent including the possible delimiter"
 	<return: #Number>
@@ -100,7 +98,7 @@ TAlbTextEditorTextualPiece >> textEndDelimited [
 	^ textEnd + delimiterLength
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> textInterval [
 	"Return both #textStart and #textEnd in a form of Interval"
 	<return: #Interval>
@@ -108,7 +106,7 @@ TAlbTextEditorTextualPiece >> textInterval [
 	^ self textStart to: self textEnd
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> textLength [
 	"Return an index of the last character of a subtext that I represent"
 	<return: #Number>
@@ -116,7 +114,7 @@ TAlbTextEditorTextualPiece >> textLength [
 	^ self textEnd - self textStart
 ]
 
-{ #category : 'text - accessing' }
+{ #category : #'text - accessing' }
 TAlbTextEditorTextualPiece >> textStart [
 	"Return an index of the first character of a subtext that I represent"
 	<return: #Number>
diff --git a/src/Album/TBlDevScripterTarget.extension.st b/src/Album/TBlDevScripterTarget.extension.st
index 7af020c..796e626 100644
--- a/src/Album/TBlDevScripterTarget.extension.st
+++ b/src/Album/TBlDevScripterTarget.extension.st
@@ -1,11 +1,11 @@
-Extension { #name : 'TBlDevScripterTarget' }
+Extension { #name : #TBlDevScripterTarget }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlDevScripterTarget >> onAlbTextEditorText [
 	self onChildFromMessage: #text
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlDevScripterTarget >> onAlbum [
 	^ self onChildFromMessage: #editor
 ]
diff --git a/src/Album/TBlTextStyleable.extension.st b/src/Album/TBlTextStyleable.extension.st
index 92793a3..87317c2 100644
--- a/src/Album/TBlTextStyleable.extension.st
+++ b/src/Album/TBlTextStyleable.extension.st
@@ -1,6 +1,6 @@
-Extension { #name : 'TBlTextStyleable' }
+Extension { #name : #TBlTextStyleable }
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> appendingAdornment: aBrTextAdornmentStencilBuilder [
 	"Append a visual element defined by a given stencil builder right after a text on which I am applied.
 	A stencil builder can also be a block in the following form:
@@ -11,19 +11,19 @@ TBlTextStyleable >> appendingAdornment: aBrTextAdornmentStencilBuilder [
 		stencil: aBrTextAdornmentStencilBuilder)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> hideText [
 	"Visually replace a piece of text with a repeating aCharacter"
 
 	self attributesBuilder attribute: AlbTextHideAttribute new
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> lineSpacing: aNumber [
 	self attributesBuilder attribute: (AlbTextParagraphLineSpacingAttribute lineSpacing: aNumber)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> onClick: aClickAction [
 	"Perform actions when a user clicks on a piece of text.
 	The click action is a block in the following form: [ :aTBrTextEditorTextualPiece :aWorldElement :anEditorElement :anEvent | ]"
@@ -31,7 +31,7 @@ TBlTextStyleable >> onClick: aClickAction [
 	self attributesBuilder attribute: (AlbTextClickAttribute new action: aClickAction)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> onCursorEnter: anEnterAction leave: aLeaveAction [
 	"Perform actions when a cursor enters and leaves a piece of text.
 	The enter action is a block in the following form: [ :aTextEditor :aBrTextEditorCursorAddedEvent :anAttributeStart :anAttributeEnd | ]
@@ -42,12 +42,12 @@ TBlTextStyleable >> onCursorEnter: anEnterAction leave: aLeaveAction [
 			leaveAction: aLeaveAction)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> paragraphMargin: anInsets [
 	self attributesBuilder attribute: (AlbTextParagraphMarginAttribute paragraphMargin: anInsets)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> replacingAdornment: aBrTextAdornmentStencilBuilder [
 	"Visually replace a piece of text with an element defined by a given stencil builder.
 	A stencil builder can also be a block in the following form:
@@ -58,19 +58,19 @@ TBlTextStyleable >> replacingAdornment: aBrTextAdornmentStencilBuilder [
 		stencil: aBrTextAdornmentStencilBuilder)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> replacingText: aCharacter [
 	"Visually replace a piece of text with a repeating aCharacter"
 
 	self attributesBuilder attribute: (AlbTextReplacingAttribute new withCharacter: aCharacter)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> roundedBackground: aPaint [
 	self attributesBuilder attribute: (AlbTextEmbellishmentAttribute new roundedBackground: aPaint)
 ]
 
-{ #category : '*Album' }
+{ #category : #'*Album' }
 TBlTextStyleable >> wordPadding: anInsets [
 	self attributesBuilder attribute: (AlbTextParagraphWordPaddingAttribute wordPadding: anInsets)
 ]
diff --git a/src/Album/package.st b/src/Album/package.st
index 4e6efdb..5eef192 100644
--- a/src/Album/package.st
+++ b/src/Album/package.st
@@ -1 +1 @@
-Package { #name : 'Album' }
+Package { #name : #Album }