170814 Python3 everywhere (at least it should be)
170608 Add --get_ss (secondary structure) using x3dna.
170518 Edit in place [experimental, only for get_rnapuzzle_ready] rna_pdb_tools.py --rpr 7_Das_7_rpr.pdb --inplace. (2) get a structure in org-mode format <sick!>
170517 Fix #37 mis-align atom names after rpr-ing bug
170515 Fix fixing missing O2'
170404 rna_simrna_extract.py -t template.pdb -f *05.trafl -c -n 1 # extract only the first model
170331 rna-pdb-tools meets Emacs!
170325 Seq: secondary structure prediction with constraints
>>> seq = Seq("CCCCUUUUGGGG")
>>> seq.name = 'RNA03'
>>> print(seq.predict_ss("RNAfold", constraints="((((....))))"))
>RNA03
CCCCUUUUGGGG
((((....)))) ( -6.40)
170324 Starting converting to Python3, fetch_align by Pietro
170320 rna_cartoon in PyMOL
170319 Add clanstix (move it from its own GitHub repository).
170315 SimRNA_trajectory:
- get len of frame, and trajectory
- warn about broken frame
only_first_frameto get only the first frame
170311 Get seq (v2) gets segments of chains with correct numbering
> 6_solution_0 A:1-19 26-113 117-172
GGCGGCAGGUGCUCCCGACGUCGGGAGUUAAAAGGGA
170308 Add fixing missing atoms of bases, and O2'
... many things! :-)
~2011 Prelimiary version as rnastruc, yapdb_parser etc.