Fixes #16

BioJulia · Nov 13, 2024 · 15e2a0c · 15e2a0c
1 parent 2424518
commit 15e2a0c
Show file tree

Hide file tree

Showing 5 changed files with 22 additions and 4 deletions.
diff --git a/src/GFF/GFF.jl b/src/GFF/GFF.jl
@@ -8,7 +8,7 @@ using CodecZlib
 
 import ..GenomicAnnotations: Record, Gene, AbstractGene, GeneDataView, Locus, Join, Order
 import ..GenomicAnnotations: SpanLocus, ClosedSpan, Complement
-import ..GenomicAnnotations: sequence, iscomplement, iscomplete, addgene!, pushproperty!, feature, index, locus, oneline
+import ..GenomicAnnotations: sequence, iscomplement, iscomplete, addgene!, pushproperty!, feature, index, locus, oneline, ismultilocus
 export sequence, iscomplement, iscomplete, feature, index, locus
 
 include("reader.jl")

diff --git a/src/GFF/writer.jl b/src/GFF/writer.jl
@@ -55,10 +55,10 @@ function gffstring(gene::Gene)
             end
         end
     end
-    if locus(gene) isa Union{Join, Order}
+    if ismultilocus(gene)
         s = String(take!(buf))
         res = IOBuffer()
-        for pos in locus(gene).loc
+        for pos in (locus(gene) isa Complement ? locus(gene).loc.loc : locus(gene).loc)
             println(res, join([parent(gene).name,
                 get(gene, :source, "."),
                 feature(gene),

diff --git a/src/GenomicAnnotations.jl b/src/GenomicAnnotations.jl
@@ -7,7 +7,7 @@ using BioSequences
 
 export GenBank, GFF, EMBL
 export Gene, AbstractGene, GeneDataView
-export sequence, iscomplement, iscomplete, addgene!, pushproperty!
+export sequence, iscomplement, iscomplete, ismultilocus, addgene!, pushproperty!
 export feature, index, locus, locus!, position
 
 export AbstractLocus

diff --git a/src/record.jl b/src/record.jl
@@ -352,6 +352,16 @@ iscomplete(locus::Complement) = iscomplete(locus.loc)
 iscomplete(loci::Join) = all(iscomplete, loci.loc)
 iscomplete(loci::Order) = all(iscomplete, loci.loc)
 
+"""
+    ismultilocus(gene::AbstractGene)
+    ismultilocus(loc::AbstractLocus)
+
+Return `true` if `loc` is a `Join`, `Order`, or either wrapping in `Complement`.
+"""
+ismultilocus(gene::AbstractGene) = ismultilocus(locus(gene))
+ismultilocus(locus::Union{SpanLocus, PointLocus}) = false
+ismultilocus(locus::Union{Join, Order}) = true
+ismultilocus(locus::Complement{T}) where T <: AbstractLocus = ismultilocus(locus.loc)
 
 function appendstring(field, v::Bool)
     return "\n" * join(fill(' ', 21)) * "/$field"

diff --git a/test/runtests.jl b/test/runtests.jl
@@ -119,6 +119,14 @@ using Test
         @test sequence(chr.sequence, Locus("complement(order(1..3,11..13))")) == [dna"tat", dna"ttt"]
         @test sequence(chr.sequence, Locus("join(complement(1..3),complement(11..13))")) == dna"ttttat"
         @test sequence(chr.sequence, Locus("order(complement(1..3),complement(11..13))")) == [dna"ttt", dna"tat"]
+
+        @test ismultilocus(Locus("join(1..3,7..9)")) == true
+        @test ismultilocus(Locus("order(1..3,7..9)")) == true
+        @test ismultilocus(Locus("complement(join(1..3,7..9))")) == true
+        @test ismultilocus(Locus("join(complement(1..3),complement(7..9))")) == true
+        @test ismultilocus(Locus("1..10")) == false
+        @test ismultilocus(Locus("<1..>10")) == false
+        @test ismultilocus(Locus("1^2")) == false
     end
 
     seq = dna"atgtccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattgccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagctctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaagaaccgccaatagacaacatatgtaa"